Sacbrood virus isolate II-10 polyprotein gene, complete cds.

NCBI Accession No: JX194121

META_INFO
VOUCHER_INFO NCBI_Accession : JX194121
DESCRIPTION Sacbrood virus isolate II-10 polyprotein gene, complete cds.
SOURCE  
ORGANISM Sacbrood virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Iflaviridae; Iflavirus.
CITATION I  
STATUS Unpublished
TITLE Rangeshwaran,R., Shylesha,A.N., Ashwitha,K., Jalali,S.K., Krishna Kumar,N.K., Rajan,R., Rajendran,T.P., Devanesan,S. and Bhat,N.S. Occurence of Sacbrood virus in Apis cerana
CITATION II  
STATUS Direct Submission
TITLE Rangeshwaran,R., Shylesha,A.N., Ashwitha,K., Jalali,S.K., Krishna Kumar,N.K., Rajan,R., Rajendran,T.P., Devanesan,S. and Bhat,N.S.
ADDRESS Submitted (19-JUN-2012) Pathology, National Bureau of Agriculturally Important Insects, P.B. No. 2491, H A Farm Post, Bellary Road, Hebbal, Bangalore, Karnataka 560024, India.
ANNOTATION  
COMPLETE_SEQ 1..8550
SOURCE dead larva
MOL_TYPE genomic RNA
DB_XREF taxon: GI:402235581
COLLECTED_FROM India
SEQUENCE
ATGGACGATATTCCTCCTATGTTTTATGGTTATGCTAGAAGTACCAACCGATTCCCCAGTAGTGGAGGAA
TCAGAAGAAATATGTCTTCTGAACATAGTTCAAGCGCCAGAACCTATAAAACCAAGTTGGAGGCGCGTAA
TTGCGGAGTGGAAAGATTATCTACAATCCTTACCTCTTGTAAGAAGACATTTGATACAGTGGACTCTTAT
ACCGATTTGTTTAATGGTTGGGTTTCTGGTATGTATGTTGACAAGAACGTCCACTACACCGAGATGTCCA
GTGATGATAGTGGACGAAGAATCTGGAATGTTAGACGAGCAGTGTCAATTAAGACCGCAGAAGGAACTAT
AGTGTGGCGAAAAGTTATTACCTCTTATAGTTGCAAGGTGGCATCAGAATTAGCCGCTAAGAGTATATTG
GTGCAATTTGTAGGGCCAATAAGGACCCAGAGTGATGAGGTACCCTCGAAAGAATCTATTCAGGGGGACG
CTACACAGCAAAGTTCCAAGGAAGAAAATACAATAATTACACGAGATCAGCAACAGACAGTTTCGGAAAA
GATACCATCAACAGTAGGGGATTTGGTAATAGCATCTTCTGAACCAACGCAACAGTTTAAGAGTTTAACT
AATCGTTGGATGCCTATTAATTCAAGTAGAGTAACAGTAAATAGTAAAAGGGATGATATTTTGGCAAAAT
ATTACGTCCCAGAAGATTTCCTGTTGCATTATGCTAAGTGTGCGCCCAATACTATACCATTTGAGACTTA
CGTGTACGGAAAATACGAGTTAGACATGAAGTTCGTAGCTAATGGTAATAAGTTTCAGTGTGGGAAAGTT
ATTATTTCTGTAAAATTTGATAGTTATCAAGCTGATAATATAAATACAGGGTTTCAAGCAGCCTTATCGC
GACCGCATGTTATGTTAGATTTGTCAACTAATAATGAAGGAGTTCTTAAAATACCATTTAGGTATCACCG
CGCCTTTGTCAGGAATCAAACGCATAAAACAGCTACGGTAGGTATAAGGCCGGGGAAGTTTGCTAGTATT
TACGTGCAAGTGTTGTCACCGTTACAGACGGGAGAGGGAGGAGCGAATGATATGTTTATACGACCGTTTT
ACCGGTATACGCGTGCTGAATTTGCCCGAATGTCGTATAAAGTTCCATTGACCCAGATGGATGTTATAGG
TACTTTAGTATCCGGAGGACCAACACCAGCTCTTAAGGATATTTTAGTAGGTGTAGAGAGAACACTGGAT
CAATTGGGCCGAAGTAATAATCAAGATAAACCAAAGGATATAAGTAGTATAACTATAATTCCGAAACCTC
GTTTGGGTTTCCCTCATGGGAAAGGTAAGAGTGATGCAGTAGCTATGCGAGTAAATCCGGTGGCTTTAAC
ATCATTTCAAGATGTGAGTGCTTATCCTGATGAGCCTCGTACTACTTTGGATATAGCTCGCATATGGGGT
TTAAGAAGTACGTTTAATTGGGGATCAGGAGATGCACATGGCAAAGAGTTGTTTAATACAGTTTTGGACC
CAGGTTTGAGATTTTATGATCAGGACTACGAAGGACAAATAACCCCGATGGAATATGTAACTGGGTTGTA
TAACTTTTGGTCAGGACCAATAGAGTTACGATTTGATTTTGTTTCAAATGCGTTTCACACTGGAACTGTG
ATTATATCAGCGGAGTATAATCGATCATCGACTAATACGGATGAGTGTCAATCTCATTCAACTTATACAA
AAACGTTCCATTTAGGAGAACAAAAATCAGTACATTTTACTGTGCCTTATATATATGATACTGTTGTGCG
AAGAAACACGGCCAGCGCCTATTTACCGGTGACTGATTATGATAAGGCAGATAATGTTAGTAGGGCGCAG
GCTACGGGGGTTAGAGCAGAGTCTAAAATGAGAGTGAAAGTGAGAGTAGTTAATGTTTTAAGACCTGTAG
CCTCTACTACCTCAACTATAGAAGTTTTGGTGTATATGCGAGGAGGAAAGAATTACGCATTGCACGGTTT
AAAGCACTCAACTTATTGGCCGTCAAGAAGTGTGGTACCAATAGATAGTTTTCCACCTGACGGTTATGAT
CCAGTTAAGCCAATAAAGAGCACTGGGGGTAAGGGACAATCTGTGGTAGCAGCATCAAATAACCCACATA
GATTCCTACCTGCGAGTGTATCGAATCTTTGGAATGAGTATTCGAGTGATTATTTACCGCGCGTACAAAT
GGATACTGGTGCTAAGGAAGACGAAGATGAAACTGCTAATTTCAGTGATGGTGTTACTGCGATGGGTTTT
CAATCTTTGGATACTCAGGTTTCAATTAAGGATATTTTGCGTATACCAGTATTGTTGTTTAATCACCTGG
AATTGGATCCTGGTTATACAGGATTTTTTATACCTGTAATGCCGCCATCTAAAATGATGCAATATAAATC
AGGAGATAAGGAAACATCCTTTCAGCGATTAATTGGTCGTACGCCCCAAGCAGCAATAAAGAAATTATTT
AGGTTTTGGAGAGGATCTGTGCGTTATACTATTATTATACACAGTACAGATGGCCATCCTATATATGTAA
CGCACGTACCCCATACGGGAAATAGAGTGTATGGTTTAATGAAAGTGAATAATTTACACGAGTACACGAA
GGTTCCCATTTTTGGGTGTGGTTTAACAACTGAAATGATTATCCCTAGTGTAAATCCGAGTATATGTGTA
GAGGTACCATTCGATATTGAGAATAATTGGGCCGTGACATTTGAGGAAGATGCTCAGCGGAATTTCTCAG
GGAGAGACAAAGGGGATACTGTGACCGGGCATTTGGTTGTAACCCCTGTAGTGAGAGTTTATATGTCTGT
GTGGGTTGAAGCTGGGGATGATTTTGACATATCTAACTTTTATGGGCCACCGACTGTAAAGACGAATGAT
TGGAATTATGCATTCTCTGATGAGCACGCCCGAGTTCAGATGGATGACAGTGCAGAAAGAGTATACGATG
AGGGAAACCAGGTATATTACTATCCGGCCTCGAAACCAGAGGGTTTTAGTTTGGGCAATGTACGGACTTC
GGTTAGTACGTTGTGTAATATGCTTGGAAAAGTAGTAACTCCTGAGCGCGCAATGAAAACAGCGTTGTGC
GCAACTCCTTATTTTGGGTCAGCTTATATGACAGCTACTACCCTTGATGCTATAGGTAGTATGCAGAATA
CCGTAACGGGAGCAGCACAACAGCTCACGGCATCCGTTGATGCGAGGTTAGAGCAACTGTCAGCCAAGTT
TGGAGATTCAATTGACGTAATTACTACAGCGGTTAAAGAGGCTATAGGTAAAATTTCTTCTGGTATGTTT
AATATGGTCACTTATACTAGTTATTGTATAGATGTAATTTTGGATATATTAGTGGCTTGGATTGATAGAA
GTTGGACTGCAGTTGGAGTAGGAATCATTCGATTCGTGACTAAGGTTTTGGGATTGGGTGCAATTTCTAA
AGTTATGAATATGGCGACAACTTTTGGGCAGCTCATAGCTAGGGTTTATGAGCCTCCACGCCCAGTTGTG
CAAGCACCACCTCCTACAGAAGGTACACTGACTGAGGCTGTGGCAAATATACTGGGTACGCTTATGGGGG
TTTATATATCACCGTTGTCGGGAGGAAGCTATTTTAGAAATTTAATGCTGAGGATGACTAGTTCGGCTGG
GCCTTCTTATTTGGTGGGGGTTTTACGTTTTGTTGAGGCAACTTTCAATACAGTAAAGGATATGACATTA
AATGCTTTGGGTTATGTTTCTCCGGAGAATGCGGCTCTGAAAATGTTATCGGGAACATCGGCTACGATAC
AGAATTTTATAACAGATGCTCAGCTTATTACCACAGAAGCTAATGCGGCATTGGTGGGACATCCTAGCTT
CCGTGCTAAGTACTGGAACACGGTAATGCAAGCATATCAAATACAGAAGAAAATATTGACTGTTCCTCAG
TCTAGTGCTTCTCCAATCTTATCTAGATTGTGTAGTGATGTTATACGTAATAGCAATGAGAAGTTTATTG
ATATCTCTTCTTCGCCTGTGCGTTACGAACCTTTTGTGATTTGTATTGAGGGTCCAGCAGGTATTGGTAA
ATCGGAGATAGTGGAAACTCTAGCCACTGAATTATTGAAAGGAGTTAATTTAAAACGACCGCATAGTGGG
GCTACGTATTTTCGAATGCCAGGGTCTCGGTTTTGGTCCGGGTATAGGGATCAACCAGTGGTGGTTTATG
ATGATTGGGCTAATTTAACGGAACCTCAAGCTTTAATGCAGCAAATTTCGGAATTATACCAGCTTAAATC
AACTTCTACTTTTATTCCGGAAATGGCTCATTTAGAAGAAAAGAAGATTAGAGGTAATCCCCTTATTGTG
ATATTATTGTGTAATCACGCTTTTCCAGATAGTGCAGTTACTAACATGTCTCTCGAACCTAGCGCAATTT
ATCGTAGGAGAGATGTGTTATTGTATGCAGAAAGAAAACCAGAATACGAGGGGGTTAGTTTGAGAGATAT
CAGTGTTAATGAACAAACAACATTTGCTCACTTGAATTTTTATAAGTATAAGGATTTTATTAATTCGTCC
TCGTGTACATCTAAACCTGTTGCATATGAGCTGACTACCGAATGGTTGGTGTCGAAGTTTGGTAAATGGC
ACGCGCAGGAACAGATTAAAGTACAGAGACGGATGGAGAATATACGTGCAGGAATGTATGATTCTGAAGT
GGGATCTTTGCGTTTGGAAGACCCATTTAGTTTGTACTACTCAGTATCTAGTGAAGTCATTGAAAATAAT
GAAGATGTTACGACTGGGTTTCTCCCTAGTGAAATTTTAGCATTTGAGTGCAAGCGCATAGCAAACGTGA
TAGATGCTTATCAGTCTTCGGTAAGGGAAATTGTGATTCCAGATGAGCCAAATGATCCTTTTGTTACTAC
ACAGGGTGATTTTGTGGGGGTATTCATGGGAGTTGCTTTGGGTCGAGTGGTACTGGAGAAAATTTGTAGC
TTTTCATCGGAATTCATCAATTATGCTATTGATTGGTTAGTTAGTAAGCATACTGTGACCCATGAGTGTT
GTGTGTGTAAGGAGACAAAAGGTGTATCGTGGTATTGTCTGGATTCTGCGCAACTTGCACCTCAATCTAC
GCATTATATGTGCAATAGTTGTATGGTAGCATCGCGAGCAGCAAATCGGGAAGTGGTTCAGTGCCCGATG
TGTAGGAGTCCAAATTTTGAACGATGGGGCACATATCAACAAATGACAGGAATAACGATTGTAGGGCGTG
CGTTGATTATGGGATTGGTAACAGTGGATAAGGGAGTGAATGTACTCCGTCGAATATTGGGAGGTACCTT
TGGCACTATGTATGCAGCTATAATGCGTATAGCTGCTACACTTCATCCTTCGATGAGTGGGAGAACAGCG
GATTTATTAAGGATGACAGGGGCCTTGGTCGATATGAGTGAACACACGGTGCGCGAATTGCAACGTGTAG
TTACCCAAATAGATGACCCATTTGAGTCAGGGGACGAAGATGACGATGTTGGTACCAATAAAATACACTG
GCGTGACATTGTAACTTTTGACTTCGAGGAAGATGTGGCTCGCGCTCTGATGCGAGAGAGGGAAATTACT
AATATACCTTGCCTTCATATATTGTTGGGGGGAGCTTTGCATCACGTGTCTTATCGTGAGGGGGGTTATA
ACGTGCCCAATGGGGGCACTATGGTAAGAGTGCCAGAGTTGCCGTGTACATCTGACTGTTATTTTTCGGA
TATGGAAGCATTTAAGAGTTTTGCCCAACGGTATAAGGAGGAAAAGAAGATTGAAATTCAATCCTATTTG
TTGGGTTTCATTAACAATCAGCATTCTCAAGATTATTATAGAAGTCGAGTTCCACGAATTTTCCAGCCTC
ACTGGATGAGGGCTAATGAAGATTTAGCTTTAGAAATTCACAATGTTACGATGGATTGTTGGTATCAGAG
AGTAGGTGATTCGTTTGTGAACTACAAAACTTTGATAGCGGCGGCTGCGGGTTTAGTGATGGCAGTGGGA
AGCATATTTGGAATGTATAAATTCTTCTCTATGGGTACGAATCTAGCGCGTGTTGAGTTTGTACCTAGTG
GGGATGAAATTACTAGAAATTTGAAGCGAACAACTAGAACATTACAAAGAACCCGTACGGAGAGGCCTCA
CTTTCAACAAGTGAACGAACATCCATCCCTTGACTCCGTGGTGAAGAAGTATGTGGCTCGTAACTATATT
ACAATTAGTTTGTATAAGCCAGCGGGACGTGTGAAGTTAACTGCATGTGGTATTTATGGGACAGTGGCTT
TATTACCTAGGCACTATGTGCTAGCCATTAAGGAGGCCTGGGAAAAGAATGTGAAAATAACTATAACACC
GTCCCTTCTGGAGCATGAGGAGCATGTCTATACTTATGATGCAGCTGACTTCACTATATCTGAGTCTACA
GACTTGGTTATTTGGGTCCTGTCTCCGTCATTTGGAATGTTTAAGGATATAAGGAAATTTATAGCTACAG
ATGAGGATCTATCTAAACCAATTACTACGGAAGGTTCTTTATTACTGGCCCCTACTAATCGCAATCCAGT
GCTTAAGGAGCAGAGTATAGAAATACTGGGCCTACAAAATGAAATGCAAGTGTCTGAGTTAAATGGTACG
GTTTTTTATGCGAACGATGTAATATGTTATGATTATTCACAACAGGGAGCTTGTGGATCCCTGTGCTTCT
TATCCCGCTCCCAAAGACCTATTGTGGGAATGCATTTTGCTGGTCGAGGTGAAGGATCCTGTGGAGAAGG
TTATGGGGTTATTTTAACTAAAGAGGCCATTGGGGATATTTTAGCATTGAAGTCTCAACCTGTGGTACAG
TTAGAAGATTGGGAAGGACCCAGTTTAGAAGAAGCAAAAATAATTTTGCCTGAAACTAACGTGTCTTATA
TTGGGGCGGTGACAAAGGAGCAGACTCCGTACCTCCCCAAGAAAACGAAGATAAGACCAAGCCTTATCCA
GAATGTTGGTGACCTTCATCCAGTATCAGAACCATGTATACTGGATAAAACGGACTCTAGGTACCAACAT
GATGATACCCCTTTAATAGCGGGGTGTAAGAAACATGGAAGGCTTACTATAGACTTTGGTACTACGAGAG
TAGAAAGCGCTAAGGAAGCCCTTTGGGATGGTTGGTTATCGAAAATGAAACCCCTGGTGGTGAAACCCAA
GTTGTTAACACCTGAGGAGGCTGCTAGTGGCTTTCCTGATATACAGTATTACGATCCTATGATTCTCAAC
ACTAGTGCAGGATTTCCTTATGTAGCAACGAATAAGAAGCGTAAAGAAGATTACATAGTGTTTGAGCGCG
ATGAAAATGAGCAACCTATTGGGGCCACTATAGACCCCGGTGTTTTGGAGGAGATGAAGCGAAAATCTGA
GTTAAGAAGGCAAGGGGTGCAGCCCATTACACCATTTATCGATACACTTAAGGATGAGAGGAAATTACCA
GAGAAAGTACGAAAGTATGGCGGAACCCGAGTATTTTGTAATCCGCCTATTGATTATATTGTGTCGATGA
GGCAATACTTTATGCACTTTGTGGCTGCATTTATGGAACAGCGTTTTAAATTAATGCATGCTGTGGGGAT
CAACGTGCAAAGTACAGAATGGACCCTCTTAGCTTCTAAGTTGCTCGCGAAAGGAAACAATATCTGTACT
ATTGATTATTCAAATTTTGGTCCAGGGTTTAACGCTCAAATAGCGAAAGCTGCTATGGAACTAATGGTGC
GGTGGACTATGGAGCATGTGGAAGGTGTAAATGAGATAGAAGCCTACACCTTATTGCATGAGTGTTTAAA
TTCAGTCCATTTAGTATCCAATACACTGTACCAACAGAAGTGTGGATCGCCTAGTGGAGCGCCTATTACT
GTAGTGATAAATACTTTGGTTAATATTTTATATATTTTTGTAGCTTGGGAAACGCTAGTAGGAAGTAGAG
AAAGAGGGCAAACTTGGGAATCTTTCAGACAAAATGTAGAATTGTTCTGCTATGGTGATGATTTAATAAT
GTCAGTAACAGACAAATATAAGGATACTTTTAATGCATTGACAATAAGTCAATTTTTAGCACAATATGGA
ATAGTAGCAACTGACGCAAATAAAGGAGAGGAAGTTGAAGCCTATACGACGTTAATAAATAGTACGTTTT
TAAAACATGGGTTTCGTCCCCACGAAGTGTATCCACATTTGTGGCAGTCTGCGCTGGTTTGGAGTTCTAT
TAATGATACTACGCAATGGATATGGGAATGTGCTGATTTAAAGCTTGCCACTAGGGAAAATTGTCGAGCA
GCTCTGTATCAAGCGCATGGTCATGGAAGCATTGTTTACAATAGATTTAAGCAACAAGTTAATAAAGCAT
TAATTAAGCGGAAAATACAACCAATTGCTTTATCATGGAAAGAAATTGATGATTTATTTTATCCCGAAAT
TAGTTATTAG