Sacbrood virus strain S2, complete genome.

NCBI Accession No: JX270799

META_INFO
VOUCHER_INFO NCBI_Accession : JX270799
DESCRIPTION Sacbrood virus strain S2, complete genome.
SOURCE  
ORGANISM Sacbrood virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Iflaviridae; Iflavirus.
CITATION I  
STATUS Unpublished
TITLE Rangeshwaran,R., Shylesha,A.N., Ashwitha,K., Jalali,S.K., Krishna Kumar,N.K., Rajan,R., Rajendran,T.P., Devanesan,S., Bhat,N.S. and Madhusmita,P. Occurence of Sacbrood virus in Apis cerana
CITATION II  
STATUS Direct Submission
TITLE Rangeshwaran,R., Shylesha,A.N., Ashwitha,K., Jalali,S.K., Krishna Kumar,N.K., Rajan,R., Rajendran,T.P., Devanesan,S., Bhat,N.S. and Madhusmita,P.
ADDRESS Submitted (04-JUL-2012) Molecular Entomology, National Bureau of Agriculturally Important Insects, P.B. No. 2491, H A Farm Post, Bellary Road, Hebbal, Bangalore, Karnataka 560024, India.
ANNOTATION  
COMPLETE_SEQ 1..8741
SOURCE infected host
MOL_TYPE genomic RNA
DB_XREF taxon: GI:402749290
COLLECTED_FROM India
SEQUENCE
AAATCGAGATTTACTTTGACGGGGTTTGCTTGACGTTGCGTCAGACCCGTCTCTCTTGAGAGTTTTAGGT
TGTGAAGATTTATTTGTAAAAATAAATAAACAGAAAGTTCATTATATCTAGAGAGACATAATAAGTTTAT
TATGGACGATATTTCTCCTATGATTTATGGATATGTTAGAAGTACCAACCGATTCCCCAGTAGTGGAGGA
ATCAGAAGAAATATGTCTTCTGAATATAGTTCACGCGCCAGAAACTACAAAACCAAGTTGGAGGCGCGTA
ATTGCGGAATGGAAAGATTATCTACAATCCTTACCTCTTGTAAGAAGACATTTGATACAGTGGACTCTTA
TACCGATTTGTTTAATGGTTGGGTTTCTGGTATGTATGTTGACAAGAACGTCCACTACACCGAAATGTCC
AGTGATGATAGTGGACGAAGAATCTGGAATGTTAGACGAGCAGTGTCAATTAAGACCGCAGAAGGAACTA
TAGTATGGCGAAAAGTTATTACCTCGTATAGTTGCAAGGTGGCTTCAGAATTAGCAGCTAAGAGTATACT
GGTGCAATTTGTAGGTCCAATAAGGACCCAGAGTGATGAGGTACCCTCGAAAGAATCTATTCAGGGGGAC
GCTACACAGCAAAGTTCCAAGGAAGAAAACACAATAATTACACGAGATCAGCAACAGACAGTTTCGGAAA
AGATACCATCAACAGTGGGGGACTTGGTAATAGCATCTTCTGAACCAACGCAACAGTTTAGGAGTTTAAC
TAATCGCTGGATGCCTATTAATTCGATTAGAGTAACAGTAAATAGTAAAAGGAACGATATGTTGGCACAA
TATTACGTCCCAGAAGATTTCCTGTTACATTACGCTAAGTGTGCGCCTAATACCATACCATTTGAGACTT
ACGTGTATGGAAAATACGAGTTAGAAATGAAGTTCGTAGCTAATGGTAATAAGTTCCAGTGTGGGAAAGT
TATTATTTCTGTAAAATTTGATAGTTATCAAGCTGATAATATAAATACAGGGTTTCAAGCAGCTTTATCG
CGACCGCATGTTATGTTAGATTTATCAACTAATAATGAAGGAGTTCTCAAAATACCATTTAGGTATCACC
GTGCCTTTGTCAGGAATCAAACGCATAAAACAGCTACGGTGGGCATAAGGCCGGGGAAGTTTGCTAGTAT
TTATGTGCAAGTGTTGTCACCGTTACAGACGGGAGAGGGAGGAGCGAATGATATGTTTATACGACCTTTT
TACCGGTATACGCGTGCTGAATTTGCAGGCATGTCGTACAAAGTCCCATTGACCCAGATGGATGTTATAG
GTACTTTAGTATCCGGAGGACCAACACCAGCTCTTAAGGATATTTTAGTAGGTGTAGAGAGAACACTGGA
CCAATTGGGCCGAAGTAATAACCAAGATAAACCAAAGGATATAAGTAGTATAACTATAATCCCGAAACCT
CGTCTGGGTTTTCCCCATGGGAAAGGCAAGAGTGATGCAGTAGCTATGCGAGTAAATCCGGTGGCCTTAA
CATCATTTCAAGATGTGAATGCTTATCCTGATGAGCCCCGTACTACTTTGGATATAGCTCGCATATGGGG
TTTGAGAAGCACGTTTAATTGGGGATCAGGAGATGCACATGGCAAAGAGTGGTTTAATACAGTTTTGGAT
CCAGGTTTGAGATTTTATGATCAGGATTATGAAGGACAAATAACCCCGATGGAATATGTAACCGGGTTGT
ATAACTTTTGGTCAGGACCAATAGAGTTACGTTTTGATTTTGTTTCAAATGCGTTTCACACTGGGACTGT
AATTATATCAGCGGAGTATAATCGATCATCTACTAATACGGATGAGTGTCAATCTCATTCAACTTATACA
AAAACGTTCCATTTGGGAGAACAAAAATCAGTACATTTTACTGTGCCTTATATATATGATACCGTTATGC
GAAGAAATACGGCCAGCGCCTATTTACCGGTTACTGATTATGATAAGGCAGATAATGTTAGTAGGGCGCA
GGCTACGGGGGTTAGAGCAGAGTCTAAAATGAGAGTGAAGGTGAGAGTAGTTAATGTTTTAAGACCTGTA
GCCTCTACTACCTCAACTATAGAAGTTTTGGTATATATGCGAGGAGGAAAGAATTATGCATTGCACGGGT
TAAAACAGTCAACTTATTGGCCATCAAGAAGTGTGGTGCCAATAGATAGTTTTCCACCTGATGGTTACGA
TCCAGTTAGGCCAACAAATAAATCAAGAAGGGAGTTGGTTTCCTCAGATAGCAATGGGGGTAAGGGACAA
CCTGTGGTAGCAGTGTCAGATAATCCACATAGATTCCTGCCCGCGAATGTATCGAATCGCTGGAATGAGT
ATTCGAGTGCTTATTTACCGCGCGTACAAATGGATACTGGTGCTAAAGAAGATGAAGATGAAACTGCTAA
TTTCAGTGATGGGGTTACTGTGATGGGTTTTCAATCTTTAGATACCCAGGTATCAATTAAGGATATTTTG
CGTAGACCGGTATTGTTGTTTAATCATGTGGAAGTGGATCCTGGTTATACAGGTTTTTTTATACCGATAA
TGCCACCTTCTAGAATGATGCAATATAAATCAGGAGATAGGGAAACATCCTTTCAGCGGTTAATTGGCCG
TACGCCCCAAGCAGCAATAATGAACTTATTTAGGTTCTGGCGAGGATCTTTGCGTTATACTATTATTATA
CACAGTATAGATGGCCATCCTATATATGTAACGCACGTACCCCATACGGGAAATAGAGTGTATGGTTTAA
TGAAAGTGAATAATTTACACGAGTATACGAAGGTTCCCATTTTTGGGTGTGGTTTAACAAATGAAAAGAT
TATTCCGAGCGTGAATCCGAGTATATGTGTAGAAGTACCATTCGATACTGAGAATAATTGGGCTGTGACG
TTTGAGGAAGATGCTCAGCGGAATTACTCGTGGAGAGACAAAGGGGATACTGTGACCGGGCACTTGGTTG
TAACCCCTGTAGTGAAAGTTTATATGTCTGTATGGGTTGAAGCTGGGGACGATTTTGAGGTGTCTAATTT
TTATGGGCCACCGACTGTAAAGACGAATGATTGGAATTATGCATTCTCTGATGAGCACGCTCGAGTCCAG
ATGGATGATAGTGCAGAGAGAGTATATGATGAGGGAAACCAGGTGTATTACTATCCGGCCCCTAAACCAG
AGGGTTTTAGTTTGGGCAACGTACGGACTTCGGTTAGTACGTTGTGTAATATGCTTGGTAAAGTAGTGAC
TCCTGATCGCGCAATGAAAACAGCGTTGTGCGCAACTCCTTATTTTGGGTCAGCTTATATGACAGCTACT
ACTCTTGATGCTATAGGTAGTATGCAGAATACCGTTACGGGAGCAGCACAACAGCTTACGGCATCCGTTG
ATGCGAGGTTAGAGCAGCTGTCAGCTAAGTTTGGAGATTCAATTGATGTGATCACTACAGCGGTTAAGGA
GGCTATAGGTAAAATTTCTTCTGGTATGTTTAATATGGTCACTTACACTGGTTATTGTATAGATGTGATT
TTGGATATATTAGTGGCTTGGATTGATCGAAGTTGGACTGCAGTTGGAGTAGGAATCATTCGATTCGTGA
CCAAGGTTTTGGGGTTGGGTGCAATTTCTAAAGTTATGGATATGGCTACAACTTTTGGGCAGCTTATAGC
TAGGGTTTATGAGCCTCCCCGCCCAGTTGTGCAAGCACCACCCCCTACAGAAGCTACACTGACTGGCGCT
CTGGCAGGTATACTGGGTACGCTTATGGGGGTTTATATATCACCGTTGTCTGGAGGAAGCTATTTTAAAA
ACTTAATGCTGAGGATGACTAGTTCGGCTGGGCCTTCTTATTTGGTGGGGGTCTTACGTTTTGTCGAGGC
AACTTTCAATACAGTGAAGGATATGACACTAAACGCTTTGGGTTACGTTTCTCCAGAGAATGCGGCTCTA
AAAATGCTATCGGGAACATCGGCTACGATACAGAATTTTATAACAGATGCTCAGCTCATTACCACAGAAG
CTAATGCGGCATTAGTGGGACATCCTAGTTTCCGTGCTAAGTACTGGAACACGGTAATGCAAGCGTATCA
AATACAGAAGTTATTATTGACAGTTCCTCAGTCCAGTGCCTCACCAATCTTATCTAGACTGTGTAGTGAT
GTTATACGTAATAGCAATGAGAAGTTTATTGATATTTCTTCTTCGCCGGTGCGTTATGAGCCTTTTGTGA
TTTGTATTGAGGGTCCCGCACGCCTTGGTAAATCGGAGATAGTGGAAACTCTCGCCACTGAATTGTTGAA
AGGAGTTAATTTAAAACGACCGCACAGTGGGGCTACGTATTTTCGAATGCCAGGGTCTCGGTTTTGGTCC
GGTTACAGGGATCAACCAGTAGTGGTTTATGACGATTGGGCTAATTTAACGGAACCTCAAGCTTTAATGC
AGCAAATTTCGGAATTATACCAGCTTAAATCTACTTCTACTTTTATTCCGGAAATGGCTCATTTAGAAGA
AAAGAAGATTAGAGGTAATCCCCTCATTGTGATATTATTATGTAACCATGCTTTTCCGGACAGCGCAGTT
ACTAACATGTCTCTGGAACCCAGCGCAATTTACCGTAGGAGAGACGTGTTATTGTATGCAGAAAGGAAAC
CAGAATATGAGGGGGTTAGTTTAAGAGATATGAGTGTTAATGAACAAACAACATTTGCTCATTTGAATTT
TTATAAGTATAAGGATTCTACTAATTCGTCCTCGTGCACATCTAAACCTGTTGGGTACGAGTTGACTAAG
GAATGGTTGGTGGCGAAGTTTGCTAAATGGCATGCGCAGGAACAGATTAAAGTACAAAGACGTATGGAGA
ACATACGTGCAGGAATGTACGATGCTGAGGTGGGATCTTTGCGTTTAGAAGACCCATTTAGTTTGTATTA
CTCAGTATCTAGTGAAGTTATTGAAAATAATGAAGATGTTACGACTGGGTTTCTTCCTAGTGAAATTTTA
GCATTTGAGTGTAAGCGCATAGCAAACGTGATAGATGCTCACCAGTCTTCGGTAAGGGAAATTGTAATTC
CAGATGAGCCAAAAGATCCATTTGTTACTATACAGGGTGATTTTGCGGGGGTATTTATGGGAGCTGCTTT
GGGACGAGTGGTACTGGAGAAAGTTTGTAGCTTTTCATCGGAACTCATCAATTACGCGGTTGATTGGCTA
ATTAGTAAGCATAATGTGATCCATGAGTGTTGTGTGTGTAAAGAGACAAAAGGTATATCGTGGTACTGTC
TGGACTCTGCGCAACTTGCACCTCAGTCTACGCATTATATGTGCAATAGTTGTATGGTAGCATCGCGTGC
AGCGAATCGGGAAGTGGTTCAGTGTCCAATGTGTAGGAGTCCAAACTTTGAACGATGGGGCACATATCAA
CAAATGACAGGAATAACAGTTGTAGGGCGTGCGTTGATCATGGGATTGATAACAGTTGATAAGGGAGTTA
ATGTACTCCGTCGAATGTTGGGAAGTACCTTTGGCACTATGTATGCTGCTATAATGCGTGTAGCGGCAAC
ACTTCATCCTTCGATGAGTGGGAGAACAGCGGATTTATTAAGAATGACAGGGGCCTTGGTCGATATGAGT
GAACACACGGTGCGCGAACTGCAACGTGTAGTTACCCAAATAGATGACCCATTTGAGTCAGGGGAAGAAG
AGGATGATGTTGGTACTAGTAAAATACACTGGCGTGATATTGTAACTTTTGACTTTGAGGAAGATGTGGC
TCGCTCTCTGATGCGAGAGAGGGAAATTACTAATATACCTTGCCTTCATATATTGTTGGGGGGAGCTTTG
CATTACGTGTCTTATCGTGATGGGGGTTATAACGTACCTAACGGGGGAACTATGGTGAGAGTGCCGGAAT
TGCCGTGTACATCTGATTGTTACTTCTCTGATATGGAAGCATTTAAGAGCTTTGCCCAGCGGTATAAGGA
GGAAAAGAAGATCGAGATTCAGTCCTATTTGTTAGGTTTTATTAACAATCAGCATTCTCAAGATTATTAT
AGAACACGAGTTCCACGTATTTTCCAGCCTCACTGGATGAGAGCTAATGAAGATTTAGCTTTAGAAATTC
ATAATATTACGAGGGATAGTTGGTATCAGAGAGTAGGTGATTCGTTTGTGAATTACAAAACTTTGATAGC
GGCGGCTGCAGGTTTAGTGATGGCAGTGGGAAGCATATTTGGAATGTATAAATTCTTCTCTATGGGTACG
AATCCAGCGCGTGTTGAGTTTGTTCCTAGTGGGGACGAAATTACTAGAAATTTGAAGCGAACCACTAGAA
CATTACAAAGGACCCGTACGGAGAGGCCTCACTTTCAACAAGTAAATGAACACCCATCCCTTGACTCCGT
TGTGAAGAAGTATGTGGCTCGTAACTATATTACAATTAGTTTGTATAAGCCAGCGGGACGTGTGAAGTTA
ACTGCATGCGGTATTTATGGGACAGTGGCTTTATTACCAAGGCATTATGTGCGTGCCATTAAGGAGGCCT
GGGAAAAGAGTGTTAAAATAACAATAACTCCGTCCCTTTTGGAGCATGAGGAACATGTTTATACTTATGA
TGCAGCTGACTTTACTATATCTGAGTCTACAGATTTGGCTATTTGGGTCCTGTCTCCGTCATTTGGAATG
TTTAAGGATATAAGGAAATTTATAGCTACAGATGAGGATCTATCTAAACCAATTACTACGGAAGGTTCTT
TATTACTGGCCCCTACTAATCGCAATCCAGTGCTTAAGGAGCAGGGGATAGAAATAATGGGCCTTCAAAA
AGAAAAGCAAGGGTTTGAGTTAAATGGTACGGTTTTTTTTTCGAACGATGTAATATTTTTTGATTATTCA
CAACCGGGAGGTTGGGGATCCCTGTGCTTTTTATTCCGCTCCCAAAGACCTATTGTGGGAATGCATTTTG
CTGGTCGAGGTGAAGGATCCTGCGGAGAGGGTTATGGGGTTATTTTAAATAAAGAGGCCCTTGGGGATAT
TTTATCATTGAAGTCGCAACCTGTGGGACAGTTGGAAGATTGGGAAGGACCCAGTTTAGAAGAAGCAAAA
ATAATTTTGCCTGAAACTAACGTATCTTATATTGGGGCGGTGACAAAGGAGCAGACTCCATACATCCCCA
AGAAAACGAAGATAAGGCCAAGTCTTGTTCAGAATGTTGGTGACCTTCATCCAGTATCAGAACCATGTAT
ATTGGATAAAACGGACTCTAGGTACCAACATGACGATACTCCTTTGGTAGCGGGGTGCAAGAAACATGGA
AGGCTTACTATAGATTTTGGTACTACGAGAGTAGAAAGCGCTAAGGAAGCCCTTTGGGATGGTTGGTTAT
CGAAAATGAAACCCTTGGTGGTGAAACCCAAGTTATTAACACCTGAGGAGGCAGCTAGTGGCTTTCCTGA
TATACAGTATTATGATCCTATGATCCTCAACACTAGTGCGGGTTTTCCTTATGTAGCAACGGAAAAGAAG
CGTAAAGAAGATTATATAGTGTTTGAGCGCAATGAAAATGAGCAACCTATTGGGGCTACTATAGCCCCCG
TTGTTTTGGCGGAGATGAAGCGAAAATCTGAGTTAAGAAGGCAAGGGGTGCAGCCCATTACACCATTTAT
TGATACGCTTAAGGATGAGAGGAAATTACCAGAAAAAGTACGAAAGTATGGTGGAACCCGAGTATTTTGT
AACCCGCCTATTGACTATATCGTGTCGATGAGGCAATATTATATGCACTTTGTGGCTGCATTTATGGAAC
ATCGTTTTAAATTAATGCATGCTGTGGGGATCAACGTCCAAAGTACAGAATGGACCCTCTTGGCTTCTAA
GTTGCTAGCGAAAGGATATAATATTTGTACTATTGATTATTCCTTTTTTGCTCCAGGGTTTAATGCTCAA
ATACCAAAAGCTGCTATGGAATTAATGCCCCGGTGGACTATGGAATATGTGGAAGGTGTAAATGAGATAG
AGGCACACACCTTATTACATGACTGTTTAAATGGAATCCACTTAATATCCAACACGCTGTACCAACAAAA
TTGCGAACCACCCTGTGTAACGCCTATGACTGTGGTGATAAATACTTTGGTTAATATCATATATATTTTT
GTAACTTGTGAAATACTCGTAAAAAGTAGAGAAAGGGGGCAAACTTGGGAATCTTTCAAACAAAATGTAG
AATTGTTCTGCTATGGAGATGATTTGAAAATGTCCGTAACGCATAAATATAAGGATACTTTAAATGCATT
AACAATAATTCAGTTTTTAGCACAATATGGAATAGTGGCAACTGATGCAAATAAAGGAGAGAAAGTTGAA
GCCTATACGACGTTATTAAATAGTACGTTTTTAAAACATGGGTTTCGGCCCCACGAAGTGTATCCACATT
TGTGGCAGTCTGCGCTGGCTTGGAGTTCTATTAATGATACCACGCAATGGATATGGGAATGTGCCGATTT
AAAGCTGGCCACTAGGGAAAATTGTCGAGCTGCCCTGTATCAAGCGCATGGTCATGGAAGCATTGTTTAC
AATAGATTTAAGCAACAAGTGAATAAAGCATTAATTAAGCGGAAAATACAACCAATTGCTTTATCATGGA
AAGAAAGTGATGATTTATTTTATCCCGAAATTAGTTATTAGTGTTTTTTAAGGTCTCATAT