Sacbrood virus, complete genome.

NCBI Accession No: NC_002066

META_INFO
VOUCHER_INFO NCBI_Accession : NC_002066
DESCRIPTION Sacbrood virus, complete genome.
SOURCE  
ORGANISM Sacbrood virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Iflaviridae; Iflavirus.
CITATION I  
STATUS published
TITLE Ghosh,R.C., Ball,B.V., Willcocks,M.M. and Carter,M.J. The nucleotide sequence of sacbrood virus of the honey bee: an insect picorna-like virus. J. Gen. Virol. 80 (Pt 6), 1541-1549 (1999).
CITATION II  
STATUS Unpublished
TITLE Ghosh,R.C., Ball,B.V., Carter,M.J. and Willcocks,M.M. PCR for the detection of sacbrood and black queen cell viruses in honeybee.
CITATION III  
STATUS Published
PUBMED_ID direct submission
TITLE Submitted (01-AUG-2000) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA
ANNOTATION  
COMPLETE_SEQ 1..8832
SOURCE
MOL_TYPE genomic RNA
DB_XREF taxon: GI:9632406
COLLECTED_FROM
SEQUENCE
>gi|9632405|ref|NC_002066.1|Sacbroodvirus,completegenomeTACGAATCGTGATT
CGATTCATTATTTCGCCTGAGTAAATCGAGATTTACCTTGACGGGGTTTGCTTGACGTTGCGTCAGACCC
GTTATCTTTGTGATTTTTAGGTTGTGAAGATTTATTCGAGTAAGTTTATTAAACGTAGAGTTTATAATAT
AGAAAGAGGCATAATAAGTTTATTATGGACGATATTTCTCCTATGTTTTATGGAGATGTTAGAAATACCA
ACCGATTCCTCAGTAGTGGAGGAATCAGAAGAAATCAGTCTTCTGAATATAGTTCACGCGCCAGAATCTA
TAAAACCAAGTTGGAGGCGCGTAATTGCGGAGTGGAAAGATTATCTACAATCCTTACCTCTAGTAAGAAG
ACATTTGATACAGTGGACTCTTATACCGATTTGTTTAATGGTTGGGTTTCTGGTATGTTTGTTGACAAGA
ACGTCCACTACACCGAAATGTCCAGTGATGAGAGTGGACGAAGAATCTGGAATGTTAGACGCGCAGTGTC
AATTAAGACCACAGAAGGAACTATAGTGTGGCGAAAAGTTATTACTTCGTACAGTTGTAAGGTAGCTTCA
GAACTAGCTGCTAAGAGTATATTGGTACAATTTTTAGGTCCTATAAGGACCCAGAGTGATGAGGTACCCT
CGAAGGAATCTATTCAGGGGGACGCTACACAGCAGAGTTCCAAGGAGGAGAATACAATAATTACACGAGA
TCAGCAACAAACTGTTTCGGAAAAGATACCATCAACAGTTGGGGATTTGGTAATAGCATCTTCCGAACCA
ACGCAACAATTTAGGAGTTTAACTAACCGTTGGATGCCTATTAATTCAATTAGAGTAACAGTAAATGGTA
AAAGGAATGATCTTTTGGCACAATACTATATCCCAGAAGATTTTCTGTCAACTCACGCTAAGTGTGCACC
CAACACTATACCATTTGAGACTTACGTGTATGGAAAATACGAGTTGGAAATGAAGTTTGTAGCTAATGGT
AATAAGTTCCAGTGTGGGAAAGTTATTATTTCCGTAAAGTTTGATAGTTACCAAGCAGATAATATAAATA
CAGGGTTCCAGGCAGCGTTATCGCGACCGCATATTATGTTAGACTTGTCTACCAATAATGAGGGAGTTCT
TAAAATACCATTTAGATATCATCGCGCCTTTGTTAGGAACCAAACGCATAAAACAGCTACGGCAGGGATA
AGACCCGGGAAGTTTGCTAGTATCTATGTGCAAGTGTTATCACCGTTACAAACAGGAGAGGGAGGAGCGA
ATGATATGTTTATACGACCTTTTTACCGTTATACGCGTGCTGAATTTGCGGGAATGTCATACAAAGTCCC
ATTGACCCAGATGGATGTTATAGGTACTTTAATATCCGGGGGGCCAACGCCAGCTCTTAAGGATATTTTA
GTAGGTGTTGAAAGAACACTAGATCAATTGGGCCGAAGTAATAATCAAGACAAACCGAAGGATATAAGTA
GTATAACTATAATCCCGAAACCTCGCTTGGGTTTTCCTCATGGGAAAGGTAAGAGTGATGCAGTAGCTAT
GCGAGTGAACCCGGTAGCATTAACATCATTTCAAGATGTGGGTGCTTATCCTGATGAGCCGCGCACTACG
TTAGATATAGCTCGTATATGGGGTTTGAGAAGCACGTTTAATTGGGGATCAGGAGATGATCATGGGAAAG
AATTATTTAATACAGTTTTGGATCCAGGTTTGAGATTTTATGACCAAGATTATGAAGGGCAAATAACACC
GATGGAATATGTAACTGGGTTGTATAACTTTTGGTCAGGACCAATAGAATTACGTTTTGATTTTGTTTCG
AATGCGTTTCATACTGGAACTGTAATTATATCAGCTGAGTATAATCGATCATCTACTAATACGGATGAGT
GTCAGTCCCACTCAACTTACACAAAAACGTTCCATTTGGGAGAACAAAAATCAGTACATTTTACTGTGCC
TTACATATATGACACTGTAGTACGCAGAAATACGGCTAGCGCCTATTTACCGGTTACTGATTATGATAAG
GTAGATAATGTTAGTAGGGCACAGGCTATGGGGATTAGAGCAGAATCTAAAATGAGAGTGAAAGTGAGAG
TAGTTAATGTTTTGAGGCCCGTAGCCTCCACTACTTCAACTATAGAAGTTTTGGTATATATGCGAGGAGG
GAAAAACTACGCATTGCATGGATTAAAACAGTCGACTTATTGGCCGTCAAATAGTGTGGTACCCATGGAT
AGTTTTCCACCTGATGGCTATGATCCAGTTAAGCCACCAAATAGATCAAGAAGGGAGGCCTCTCCGAATA
GTGATGGAGGTAAGGGACAACCTGAGGTGGCAGTGTCAGATAATCCGCATAGATTTTTGCCCGCAAACGT
GTCTAATCGTTGGAATGAATATTCTAGCGCTTATCTGCCACGGGTACAGATGGACACTGGGGCTAAGGAA
GATGAAGATGAAACTGCAAACTTCAGTGATGGGGTTACTGCGATGGGTTTTCAATCTTTGGATACCCAAG
TGTCAATTAAGGATATTTTGCGTAGACCAGTGTTGTTGTTTAATCATGTAGAGTTGGACCCCGATTACAC
AGGTTTCTTTATACCTATAATGCCGCCTTCTAGAATGATGCAATATAAATCAGGAGATAAAGAAACATCT
TTTCAGCGGTTAATTGGGCGTACTCCCCAAGCAGCCATAATGAATTTATTCAGGTTTTGGAGAGGGTCAT
TGCGTTATACTATAATTATACATAGCACCGATGGTCACCCTATATATGTGACACATGTACCCCATACGGG
AAATAGAGTGTATGGTTTAATGAAAGTTAATAATTTACACGAGTATACTAAGGTTCCCATTTTTGGGTGT
GGGTTAACAACTGAAATGATTATTCCTAGTGTGAACCCGAGTATATGTGTAGAAGTACCATTTGATACGG
AAAATAATTGGGCCGTGACATTTGATGAGGACGCTCAAAGGAATTACTCATGGCGAGATAAAGGGGATAC
CGTGACCGGGCACTTGGTTGTGACACCTGTAGTATCAGTTTATATGTCTGTGTGGGTAGAAGCTGGGGAT
GATTTTGAGGTTTCTAACTTTTATGGGCCACCAAGTGTAAAGACGAATGATTGGAACTACGCATTCTCTG
ACGAGCATGTACAAGTTCAGATGGATGATAGTGTAGAAAGAGTTTATGATGAAGGGAACCAAGTCTATTA
CTATCCGCCCCCTAAACCAGAGGGTTTTAGTTTGAACAATGTACGGACTTCGGTTAGTACGTTGTGTAAT
ATGCTTGGAAAAGTAGTAACTCCTGAGAGAGCAATGAAAACAGCGCTGTGTGCAACTCCTTATTTTGGAT
CAGCTTATATGACAGCTACTACCCTAGACGCTATAGGTAGTATGCAGAATACCGTTACGGGAGCTGCACA
CCAGTTGACTGCATCTGTTGATGCGAGGTTAGAGCAATTGTCAGCTAAATTTGGAGATTCAATTGATGTA
ATTACTACAGCGGTTAAGGAGGCTATAGGTAAAATTTCTTCCGGTATGTTCAATATGGTTAATTATACTG
GTTATTGTATAAACGTGATCTTGGATATATTGGTGGCATGGATTGATCGAAGTTGGACTGCAGTCGGAGT
GGGAATTATTCGATTCGTGACTAAGGTTCTAGGGTTGGGTGCAATTTCTAAAGTTATGAATATGGCCACA
TCTTTTGGGCAGCTTATAGCCAGAGTATATGAACCTCCACGCCCAGTTGTGCAGGCACCACCTCCCACTG
AAGCTACATTAACTGGAGCTTTGGCGGGTATACTGGGTACGCTTATGGGGGTTTATATATCACCGTTGTC
TGGAGGTAGTTATTTTAAAAATTTGATGCTCAGGATGACTAGTTCGGCTGGGCCTTCTTATTTGGTGGGG
GTTTTACGTTTTGTCGAGGCAACTTTTAATACAGTAAAGGATATGACATTGAATGCTTTGGGCTATGTAT
CTCCAGAAAATGCGGCGCTGAAAATGCTGTCCGGAACATCGACTACGATACAGAATTTTATAACTGATGC
TCAGCTTATTACTACAGAAGCTAATGCGGCATTGGTGGGACATCCTAGTTTTCGAGCTAAGTACTGGAAC
ACGGTAATGCAAGCGTATCAAATACAAAAGTTATTATTAACTGTCCCTCAATCTAGCGCCTCCCCAATTC
TATCTAGATTATGTAGTGATGTTATACGTAATAGTAATGAAAAGTTTATTGATATTTCATCTTCACCGGT
GCGTTATGAACCTTTTGTAATTTGTATCGAGGGCCCAGCGGGTATAGGGAAATCGGAAATAGTTGAAACC
CTGGCTACTGAATTATTGAAGGGAGTTAATTTAAAACGACCGCATAGTGGGGCTACGTATTTCCGAATGC
CTGGTTCTCGATTCTGGTCTGGTTATAGGGATCAACCCGTGGTGGTTTACGATGATTGGGCGAATTTAAC
GGAACCCCAAGCTTTAATGCAGCAAATATCGGAATTATATCAGCTTAAATCAACTTCTACTTTTATTCCG
GAAATGGCTCATTTAGAAGAAAAGAAAATTAGGGGTAATCCCCTCATCGTGATATTATTGTGTAATCACG
CTTTTCCAGATAGTGCAGTTACTAATATGTCTCTTGAACCTAGTGCAATTTATCGTAGGAGAGATGTGTT
ACTGTATGCGGAAAGAAAACCAGAATATGAAGGAGTTAGTTTGAGAGATATGAGTGTTAATGAACAAACC
ACGTTTGCTCATTTGAATTTTTATAAGTATAAGGATTCCACCAACTCATCTTCGTGCACATCCAAACCCG
TTGGATATGAGTTAACTAAGGATTGGTTGGTTGCGAAGTTTGCTAAATGGCACGCGCAGGAGCAAATTAA
AGTACAGAGACGTATGGAGAATATACGAGCAGGAATGTACGACGCTGAGGTAGGATCTTTGCGTTTGGAA
GATCCATTTAGTTTATATTACTCAGTTTCTAGTGAAGTCATCGAAAATAATGAAGATGTTACGACTGGGT
TTCTTCCTAGTGAGATTTTGGCTTTTGAGTGTAAGCGTATAGCAAATGTGATAGATGCCCATCAGTCCTC
GGTAAGGGAAATTGTGATTCCAGATGAGCCAAAAGATCCATTTGTTACTACACAGGGTGATTTGGCGGGG
GTATTTATGGGAGCTGCTTTGGGTCGAGTGGTACTGGAAAAAGTTTGTAGCTTTTCATCGGAACTTATTA
ATTATGCGGTTGATTGGATAATCAGTAAGCATAATGTCACCCACGAGTGTTGTGTGTGTAAAGAGACAAA
AGGTATCTCATGGTACTGCTTGGATTCTGCGCAACTTGCACCTCAAGCTACGCATTATATGTGTAACAGT
TGTATGGTTGCATCGCGCGCAGCAAACCGAGAAGTAGTCCAGTGCCCGATGTGTAGGAGTCCAAATTTTG
AAAGATGGGGTACGTATCAACAGATGACAGGAATAACGATTGTGGGGCGTGCATTAATTATGGGATTGAT
AACAGTTGATAAGGGAGTTAATGTATTACGTCGAATGTTGGGAGGTACTTTTGGTGCTATGTATGCGGCT
ATAATGCGCATAGCTGCTACACTTCACCCTTCGATGAGTGAGAGAACAGCGGATTTATTAAGGATGACAG
GGGCCTTGGTAGATATGAGTGAATATACGGTGCGAGAACTGCAACATGTGGTTACTCAAATGGATGATCC
CTTTGAATCGGATGGTGAAGATGATGATGTTGGTACAAGTAAGGTACATTGGCGAGATATTGTAACTTTT
GATTTCGAGGAAGACGTGGCTCGCTCGTTGATGCGAGAGAGGGAAATTACTAATATACCTTGCCTTCATA
TATTGTTGGGGGGTGCTTTGCATCATGTCTCGTATCGTGATGGAGGTTACAACGTACCCAATGGGGGAAC
TATGGTGAGAGTACCGGAGTTGCCGTGTACATCAGATTGTTACTTTTCTGATATGGAAGCATTTAAAAGT
TTTGCCCAGCGGTACAAAGAGGAAAAGAAGATTGAGATCCAATCCCATTTATTAGGTTTTATTAACAATC
AGCACTCTCAAGATTATTATAGGAAGCGAGTCCCGCGTATTTTCCAGCCTCACTGGATGAGAGCGAATGA
AGATTTAGCTTTGGAAATTTCTAATATTACAGCGGATGGTTGGTACCAGAGAGTAGGTGATTCGTTTGTG
AATTATAGAACTTTGATAGTGGCGGCTGCGGGTTTAGTGATGGCAGTGGGGAGTATATTTGGAATGTATA
AATTCTTCTCTATCGGTACGAATCCAGCGCGTGTTGAGTTTGTACCTAGTGGGGATGAAATTACTAGAAA
CTTGAAGCGAACAACTAGGACTCTGCAAAGGACCCGAACGGAGAGGCCTCACTTTCAACAAGTGAACGAA
CACCCATCCCTTGATTCAGTGGTTAAGAAGTATGTGGCTCGTAACTATATTACTATTAGTTTGTATAAAC
CCGCGGGGCGTGTGAAGTTAACCGCATGCGGTATTTATGGAACAGTGGCGTTATTACCGAGGCATTATGT
GCGTGCCATTAAGGAGGCTTGGGAAAAGAGTGTGAAAATAACTATAACTCCGGCACTCTTGGAGCATGAG
GAGCATGTCTATACTTATGATGCTGCTGATTTCACTATATCTGAGTCTACAGATTTGGCTATTTGGGTAT
TGTCTCCGTCATTTGGAATGTTTAAGGATATAAGGAAGTTTATAGCCACAGATGAGGACCTATCTAAACC
AATTACTACGGAAGGGTCCTTGTTGTTGGCTCCAACCAATCGTAATCCAGTGCTTAAGGAACAGAGTATA
GAGATACTGGGACTACAAAATGAAATGCAAGTATCTGAGTTAAATGGCACGGTATTTTATGCGAATGATG
TAATCTGTTATGATTATTCACAACAAGGAGCTTGTGGATCTTTGTGTTTTTTGTCCCGCTCGCAAAGACC
TATTGTGGGAATGCATTTTGCTGGTCGGGGCGAAGGATCCTGTGGAGAAGGTTATGGAGTTATTTTAACT
AAAGAAGCCATTGGGGACATTTTAGCACTTAAGTCCCAACCTGTAGTGCAGTTAGAAGATTGGGAAGGAC
CCAGTTTAGAAGAAGCAAAAATAATTTTACCTGAAACTAATGTGTCTTATATTGGGGCGGTGACAAAGGA
GCAAACTCCTTACCTCCCCAGGAAAACGAAGATAAGGCCAAGTCTTATTCAGAATGTTGGTGACCTTCAC
CCAGTGTCAGAACCGTGTATATTGGATAAAACGGATCCCAGATACCAACATGATGATACTCCTCTAGTAG
CGGGGTGTAAGAAACATGGAAGGCTTACTGTGGATTTTGGTACTACTAGAGTAGAAAGTGCTAAGGAAGC
TCTTTGGGATGGATGGCTATCGAAAATGAAACCCCTGGTAGTAAAACCTAAGTTATTAACGCCCGAGGAG
GCTGCTAGTGGTTTTCCAGATATACAGTACTATGATCCTATGATTCTCAACACCAGCGCGGGTTTTCCTT
ATGTGGCAACAGAAAAGAAGCGTAAAGAAGATTATATAGTATTTGAGCGCAATGAGAACGAGCAACCGAT
TGGTGCCACTATAGATCCTGGTGTTTTGGAGGAGATGAAGCGAAAATCTGAGTTGAGAAAGCAAGGGGTG
CAGCCTATTACGCCTTTTATTGATACACTTAAGGATGAAAGGAAATTACCAGAAAAAGTACGAAAGTATG
GTGGAACCCGAGTGTTTTGTAACCCTCCTATCGATTATATTGTATCAATGAGGCAATATTATATGCACTT
TGTTGCTGCATTTATGGAACAGCGTTTTAAGCTAATGCATGCAGTGGGAATTAATGTTCAGAGTACAGAG
TGGACGCTTTTAGCTTCTAAGTTGCTAGCGAAAGGGAATAACATTTGCACCATTGATTATTCAAATTTTG
GTCCGGGTTTTAATGCTCAAATAGCGAAAGCTGCTATGGAATTAATGGTGCGGTGGACTATGGAGCATGT
TGAGGGCGTAAACGAGATAGAGGCGTATACTTTATTACATGAGTGTTTAAATTCGGTTCACTTAGTGTCT
AATACGCTGTACCAACAAAAGTGTGGATCACCTAGTGGCGCGCCCATTACTGTAGTGATAAATACTTTGG
TTAATATTTTATATATATTCGTAGCTTGGGAGACGTTAGTAGGAAGTAAAGAACGAGGGCAAACTTGGGA
ATCCTTTAAACAAAATGTAGAATTGTTTTGCTATGGTGATGATTTAATAATGTCAGTAACAGATAAATAT
AAGGATGTTTTTAACGCATTAACAATAAGTCAATTTTTGGCACAATATGGAATAGTAGCCACTGATGCAA
ATAAAGGAGACGAAGTTGAGGCTTATACGACGTTGTTAAATAGTACGTTTTTAAAACATGGGTTTCATCC
CCACGAAGTGTATCCGCATTTGTGGCAATCTGCGCTGGCTTGGAGTTCTATCAATGATACTACACAATGG
ATATGGGAATGTGCTGACTTGAAGCTGGCTACTAGGGAGAATTGTCGAGCCGCTCTGTATCAAGCGCATG
GTCATGGAAGCGTCGTTTACAATAAGTTTAAGCAACAAGTAAACCAAGCATTAATTAAGCGGAAAATACA
ACCAATTGCTTTATCTTGGAAAGAAATTGATGATTTATTTTATCCTGAAATTAGTTATTAGTGTTTTTTA
AGGTCTCATATAAGCTATAAAGGTTATGGGTACTAATATAGTGGATTAATATCGATATATGGCATTTT