Acute bee paralysis virus, complete genome.

NCBI Accession No: NC_002548

META_INFO
VOUCHER_INFO NCBI_Accession : NC_002548
DESCRIPTION Acute bee paralysis virus, complete genome.
SOURCE  
ORGANISM Acute bee paralysis virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Dicistroviridae; Aparavirus.
CITATION I  
STATUS published
TITLE Govan,V.A., Leat,N., Allsopp,M. and Davison,S. Analysis of the complete genome sequence of acute bee paralysis virus shows that it belongs to the novel group of insect-infecting RNA viruses. Virology 277 (2), 457-463 (2000).
CITATION II  
STATUS Direct Submission
TITLE Govan,V.A. and Davison,S.P.Submitted (11-MAY-1999) Microbiology, University of the Western Cape, Modderdam Road, Bellville, Cape Town 7535, South Africa
CITATION III  
STATUS Published
PUBMED_ID
ANNOTATION  
COMPLETE_SEQ 1..9491
SOURCE
MOL_TYPE genomic RNA
DB_XREF taxon: GI:10314010
COLLECTED_FROM
SEQUENCE
>gi|10314009|ref|NC_002548.1|Acutebeeparalysisvirus,completegenomeCCCG
TCAAAATAACAACTTATAACACGATGTTACCCGAAGAAACCATTTTAGTGTAACATTTAAGATTAGAAGT
AGTTCATCTAATAGAGATAGGCACTATTAGAAGGAGGCCTTTTCTAAAGGAGCCGTTAGTCAGCCCAGAC
AAGCGCAGTACTTTAGAAGAGAGAAGTTCCCCGATAGCGACCGAAAAGACGCGTTTTCCGTGCTAACTAA
TTTAAATGTGGGAACGAATATTATTATTGAAATTATGTGAGCCACGTAGCAATCAAGTCATGTTTTTGTC
ACTACGTTTACTCATCTAATGTAGATAATTTTGTTTAAGTACCTATTTAGGTGTCATCCCACCAGAGAAG
AAATAATACGTACCGGAACCCAGAGTACACCCCTTATTTTAAGCCTTACTGGGCTTCTCTGTTAGTTAGT
AATCTGGCCCACGTTTTGCGTTGAGTGGGGTCCCAACAGTAGGAATTCGACGGACAAGTAGCAAGCGAGT
CGGTACCAATTGGTTTAGCCTTCGAAATTACTCTGGGCAGGAAGTTACTAAACGAGAACTTTCTGCTTAA
ATCCCAACGCACAAACAAATAGAGTAAATAAATAATTATAATGAATTTTACAAAGCAACCAGCAAGTCTC
AAATATTTATCAAGCATGAAACTTATAACTTCACAAGACCAAGATTTCTTTAACTTTGGAGAAGTTTCAC
GAGAATTTATATTGGAACAGGCATACGTCAATGGATACGATTTCCACATGCTACATCAAGACATGAATTG
TATAGGATTCGTACTATCAATTTTTGATGAAGATGCTAGAGATGAGTATGAATACAAAGATCTGAATTGT
GAATATCATGAGAATTTATTTGATGCAGTAGTAGATTCTGAATTTGATAAAATTTGGCCACACTTGGTTT
TGAAATATATAACATATTATCCATGTAGTTTGAATTGGAGGGGTATGCCAACTATACCTATTGTTTATGT
TTCAAAACATTTTTGGTATGAATTGTATAGAACTGGTTTTTTAAACAAGTTATATCATTGTGGCTCATGG
ACTGACATATTGTTGTTGTTGTCTGGAGATGTAGAAACCAATCCAGGACCTGTTGAAACGTATAAAGACT
TATGCAGAAGGAAAAATATTCGTAAGAGAAAATCTCGAATTCGAGAAGAAATCAAAATGCAACAACATAT
TGATAAGATAATAGGGCAGGAGAATGAAGAGTATAAGATTATAAACGTCAATATGCAGGGAATCTTTAGT
TTTAATGAAGAAAAAGAAATAATTAAAAGTACGGCTTGGAAATTCAATAGCACTCTAGACAAAACAAATT
CTATAATAGACAATTTAATACCCCAATTAGAAGAAACTTTAGCAGGTTTCAGAAAAACATATTCAAAATG
TGAATCAAAAATTTTTGGTACTATAAGTGTGGTTGATGTGTGTGTAGATTTGATTAGTGCTTTATTACAA
GTTAGTTTTGCTAAACCAGCAATGAAGATAGCTTCATTAGCAGTAGAAGTTTTTAGATTAATTAAGAAAT
ATGTTAGCAATATTAATATCAATATCGATAAGATTAAAGAATTGTTATCTTATGGTAAGGTAGCTCTTAA
CAATAATAATCCAATTATTCATGTAACAATGCAATCTAATTCTCCCATTCTTGAAGTTTTATTACAACCC
AACATTATAGTTAGCGCCATATTTATAGCATTAAGCGTAGTGTTCCACAAAAAATTTACCTACAAAAAAC
TGGGAATTGAAGCAATGATTAAAAGACTTGGAGATTTGGGAAGAGCAGCCAAAGGCTGTTCAGATTTGAA
TGTGGTGCTCAACCAGGCTATAACCAACCACATGTTAGAACATTTTGGGAAGAATGTTCTTGGTTTAAAA
CAAGAAGATGAACTCAAAGTCCTAGTGGAAGGATATAGAAATTGGTGTGATGAAGTCAGAGATTTAGTAG
GACATAAAATCAATTCAGATGGGGAATTAGACAGCAAAAGTATCGTTGAAAATATAATGAAGGATGTTTA
TGAGATACAAAGAATTGAGAATATGTATAAGAAAGGTTTGGAGATTTCTCGTAACATAGCTGAATTAAAG
TTACCAACAAAATTAACAATTAGTTTTAATACGCACATGAGATACTTGACTGAAGTTTTCAAATCAGTTG
ACACATCTGGAGCTTTTGGAAACAAACCTCGAACGCAACCAATAGTTATTTGGCTTTTTGGAGAATCAGG
AAGAGGAAAATCGGGGATGACTTGGCCTCTAGCAATAGATCTAAATAACAGCTTACTTGATAATGTAGAT
GAAATGAGGAATTTTTCAAAGAACATCTATATGAGAAATGTTGAACAGGAATTCTGGGATAATTATCAAG
GACAAAATATTGTATGTYATGATGATTTTGGACAAATGAGGGATTCATCATCTAACCCTAACCCTGAATT
TATGGAGTTAATACGTACAGCTAACATAGCTCCATACCCCTTACACATGGCTCACCTCGAAGATAAAAGG
AAAACAAAATTCACATCAAAAGTAATCATTATGACATCTAATGTTTTTGAACAGGATGTTAATTCACTAA
CATTTCCAGATGCATTTAGGAGAAGAGTAGATTTGTGCGCTGAGGTAAAGAATAAAGATGAATTTACAAA
AATGTGCTGGTCTAAATCAGCAGGAAAAATGGTTCAGAGATTAGATAAGGGAAAGGTTAAGAAAATAACA
GGAGATATTCATTCAACAGTACCATACATTGTTGATCTGATTGATCCAGAAAGCGGGGAAGTGTATAAGA
CTGGATTAGAATATGAAGAATTTCTCGATATGTGTCTAGAAAAGACTAGTCAATGTAGAGATGATTCTGC
AAAATTAAATGATTTTTTAATGGATTATGCAGAGAAAAGAGCAAATAGAAGCAGAGAAATTGATGAAGTT
TGCGCACGTACTATGGATGAAGCTTTTGTTGACGCATATGATGACGTCATCGATGTAAACATGCAAATTG
AAACAGTTGATGAAATGGAACTGATTGAACCCAACAAATTAAGAGAGATGATAGAACAATGCTCAAATAA
GATAGTATACACGTATGAAGGAATAGCTGTTAAAATAACATCATTAGCATTTAAACTAGCCACACTAAAC
TACGAAGAACAATGGGAACAGATTAAGGAAATGAAATATTATGTTAAAGTGAGTTCAGGTGTGAACTATC
TTAAAAGAGTGTTAAGTCAGGGTATGAAAGTGTGTGAAGAATGGATGAAAGAAATGATTAACTACGTTAA
GGAACATCCATGGATGACCGTTAGTTTAATACTGGGCACTCTCATTGGAATACTTACTGTTGTAGGGTTT
TGGAAATGGTTATGTAGTGGCGATAAAAAGAAGAATCCGATAAAAAGACATTTTATTAATACAGGCAATG
TTCTAATCTTACCCGATAGAGAATTAAACACCTTTTGGAAAAATCAAGAATCATTGGACTTAAGGGATAT
GTATATTAATCGAGTTGAAGAACACATAATTAGCCTATTGAAATTGCAACATAAAGTAGTCTTAGTTCCA
AAAGTTACTAAGTATATTCTTACAACTGTTGAGAACCATGCTAAAATATCAGATAAAATCATTTTGATTA
CAAGAAATAGATATTTGAATTACCAGGGCAAGTTTGTTGAATTGATTTGTGGAGAAATTAATCAATTCTT
CATTGACCCGGAAACATTAGATACCAACGTGGAAGCTTTTGCTTCAGCTGATCTTAAGACATTTGTACAA
AGGAAACCTATTGTCATTGAAGGACCTGAATTTGTAGAGGCACAAACATCAGGAGATCAGATTACATTAA
GGAAACAAACACAAAAAGTCATAGAGGCATTCGCTAGTTCAGATGCAATCACAATGGCTCGCAAAACACC
AAAGTTTGTTGAGAGTGATGATGTGGTCGAAGTTTCAATGCAAATGTGGAAAGATCAAGTTGCGCAAAAG
TTGATAACTAACCGAGTTTTAACAAACCTGTATAAAATTTGTTTAGTTAAGGAGAATGGTGATATGGTAC
CGCTGCTAAATGGTTTGTTTGTTCGTTCAAACATAATGTTAGCCCCTGGACACTTAGTGGGTTTCTTATC
AGATAGTGATACAATTGAAATAAGAAATCTATTTGATGTAGTTTTCAGAGTACCATGGAAAGACGTGAAG
AAAGTTGACGTAGTAAACGCCTTCGGTGAGAGCAAAGAAGCGGTTTTGTTATGTTTTCCGAAATTTGTAT
GTCAACACACGGATTTGGTGAAGCATTTTCAAGATTCAGAATCTATGTCAAAATTCAAAAGATGTGAGGT
CACTCTTCCAGTGTTGAGATATTCAGATAAAATGAATAGATTTTTAGCAACATTAATAGAATGTGACAAA
GTTGAAGCTTATGATAGACCATACACTTTAAATGACTCATCAAAAGGACAATATATATTAAGACAAGGAT
TGGAATACACCATGCCAACAACAAATGGGGATTGTGGTGCACCATTAGTAATTAATGAAACCCAAGTTAT
ACGTAAAATAGCTGGAATTCATGTTGCTGGTGATGCCCGAGGAAAAGCTTATGCAGAATCAATAAGTCAA
AAAGATTTAATAAGAGCTTTTTCTAAAATTGACGTTAGTATGCAGATTCAATTGGACCTAGATCAGACAT
TGAATTTTAACCAACAGCAGAVAATAATACCACCAAACGCAGAATTCGGACCTGAGGATTTAGATTTTTG
CGATTTGCCTTCACTTAAAATGATACCAGTGGGTAGATTGAGTGAACCTTTGTTCGAACCTGGTAAGACA
GACATACGACCTTCCCTGGTATATGGAAAAATCTCAGAAATTAAGACAAAACCCGCCATCCTAAGAAATG
TGATAGTGGATGGAAAAATTGTTAATATAAAACATAAAAACTTGAAGAAATGCGCCATGGACACACCCTA
TGTGTCAAAAGAAATGACTGAAGAAGCTTTTCAGTTAGTTAAATCAGTCTGGTTAAAGGGAATGCGTAAT
GAATTGAAGAAAGTTTTGACTTATGAGGAAGCTATTTGTGGAAATGATTCAAGTGAATTTATATCAGCAA
TAAATAGATCTAGTTCACCGGGTTTCCCATGGATACGCGATAGAATTAAAGGAACTAAAGGGAAGCAAGG
TTGGTTTGGTGCGGAAGGCGAATATATTCTGGATGAAGATGTCTTTGAAGCGGTTAAAACACGTATTCAG
AATGCAAAGAATGGTGTGAGAACACCTGTAATGTGGGTGGATACATTAAAGGATGAGAGAAGACCAATTG
AAAAAGTAGATCAACTGAAAACACGTGTGTTTTCTAATGGGCCTATGGACTTTTCTATCACTTTTAGAAT
GTACTATTTGGGCTTCATAGCACACCTTATGGAAAATCGAATAACCAATGAAGTATCCATAGGAACTAAT
GTTTATTCCCAAGATTGGAATAAGACAGTTAGAAAACTTAAAACTATGGGACCCAAGGTTATTGCAGGAG
ATTTCTCAACCTTTGATGGATCTTTGAATGTTTGCATTATGGAAAAATTTGCTGACCTAGCGAATGAATT
TTATGATGACGGATCAGAGAATGCATTAATTCGACATGTTTTGCTTATGGATGTATATAACTCAACACAC
ATTTGTGGTGATTCCGTATATATGATGACACACAGTCAACCCTCTGGTAATCCGGCAACAACACCTCTAA
ATTGTTTCATAAACAGTATGGGCTTGCGAATGGTCTTTGAACTTTGTTCAAAGAAATATTCCGCCCTTAA
CGGAACAAAATGCTATGTAATGAAAGACTTTTCTAAGCATGTAAGTATAGTTTCTTATGGAGATGATAAT
GTTATTAACTTTAGTGATGAAGTTAGTGAATGGTTCAACATGGAAACTATTACTGAAGCTTTTGAGAAGT
TAGGGTTTACGTATACTGACGAACTTAAAGGCAAGAATGGAGAAGTACCAAAATGGCGAACTATTGAAGA
TGTGCAATATCTCAAAAGGAAATTTCGATATGATTCTAAACGGAAAGTATGGGAAGCGCCATTGTGTATG
GACACAATACTGGAAATGCCTAATTGGTGTCGAGGAAGTCTCGACATTCAAGAAGGAACTAAAGTTAATT
GTGAAAATGCAATTATGGAGCTTTCTATGCATGAGGAATATGTATTTGATAAGTGGTCCAAAGTGATTTC
TAAGGCCTATCAGAAGGCCACTGGAGATTGTTTGGATATCAGTACATATAATGGTTATGCTCAGGAGAGA
TTCCTAAATTACTACTTGTAATTTGGGAATCGCAACACAACATGGTTACCCATAGATTGAGGAAATTTCC
AATAAACTCAGTATTAAGGCTTGTTGTGTTGGACAAGGTGCCCTATTTAGGGTGAGGAGCCTTACTGGCA
GCCCCAGTGAATCCTCCATTGGATAGGAACAGCTATATTGGGTAGTTGTAGCAGTTGTATTCAAATGAAT
GCAGCGTTCCGAAATATCATACCTGCCGATCAAGAAACAAATACTTCCAACGTACATAATACGCAACTCG
CGTCGACCTCTGAAGAAAACTCAGTTGAAACGGAACAAATCACCACCTTTCATGATGTGGAAACTCCAAA
TAGGATCAATACCCCCATGGCTCAAGACACTTCATCGGCTCGGAGCATGGATGATACGCACAGTATTATT
CAGTTTTTACAACGCCCCGTACTCATTGACCACATTGAGGTCATTGCTGGATCAACAGCAGATGATAACA
AACCCCTCAATAGATATGTGTTAAATCGACAGAATCCACAACCATTTGTTAAATCTTGGACATTGCCTTC
AGTAGTTTTAAGTGCTGGAGGTAAGGGACAAAAATTAGCTAATTTTAAATATTTACGATGTGATGTTAAA
GTCAAAATTGTTCTAAACGCAAATCCTTTCATAGCTGGAAGATTATACTTAGCATATTCACCTTATGATG
ACCGAGTGGACCCAGCGCGTTCAATTTTAAACACCTCACGAGCTGGAGTTACGGGATACCCTGGAATAGA
GATTGATTTTCAATTAGATAATTCCGTAGAAATGACCATACCATACGCTTCTTTTCAAGAAGCATATGAT
TTAGTCACAGGTACTGAAGATTTTGTCAAGCTATATCTATTTACAATAACGCCCATATTATCCCCGACTA
GCACATCTGCTAGTTCAAAGGTGGACCTTTCAGTTTATATGTGGTTGGATAATATTTCCTTAGTCATACC
CACGTATCGCGTTAACACGAGCATCGTACCAAATGTGGGGACTGTTGTTCAGACAGTACAAAATATGACT
ACACGAGACAGTGAAACAATTAGGAAAGCAATGGTTGCATTAAGGAAAAATAATAAATCAACTTACGACT
ATATAGTGCAAGCTTTATCTTCTGCAGTTCCAGAAGTTAAGAATGTAACTATGCAGATCAATTCCAAGAA
AAATAATTCCAATAAAATGGCAACACCTGTTAAGGAAAAAACAAAAAATATACCCAAACCAAAGACTGAA
AATCCGAAGATTGGACCAATATCAGAACTAGCCACAGGAGTCAACAAGGTGGCGAATGGTATTGAGAGAA
TACCTGTGATTGGAGAGATGGCAAAACCTGTAACTTCAACAATTAAATGGGTTGCTGACAAGATTGGATC
TGTGGCAGCAATTTTTGGATGGTCGAAACCCAGAAATCTAGAACAAGTTAATTTATATCAGAATGTTCCT
GGATGGGGTTATTCACTCTATAAGGGAATAGATAATAGTGTGCCATTGGCTTTTGACCCCAATAACGAAC
TAGGTGATTTGAGAGATGTATTTCCTTCTGGAGTTGATGAAATGGCGATAGGATATGTTTGTGGCAATCC
TGCTGTTAAACATGTGCTATCTTGGAATACTACGGATAAAGTTCAAGCACCAATAAGTAATGGAGATGAC
TGGGGAGGAGTGATACCTGTTGGTATGCCATGTTATTCTAAAATCATACGGACAACAGAGAACGATACGA
CACGGACTAATACTGAAATTATGGATCCTGCCCCTTGTGAATATGTTTGCAATATGTTTTCATATTGGCG
AGCTACTATGTGCTATCGTATAGCTATAGTTAAAACAGCTTTTCACACTGGTAGGTTAGGAATTTTCTTC
GGACCTGGTAAGATTCCAATAACGACGACGAAAGATAATATTTCCCCGGACTTGACTCAGTTAGATGGAA
TTAAAGCGCCTTCTGATAACAATTACAAATACATCTTGGATCTAACTAATGATACGGAGATCACCATAAG
GGTACCTTTTGTTTCAAACAAAATGTTCATGAAATCTACGGGAATTTATGGTGGAAATTCTGAAAATAAT
TGGGATTTCTCTGAATCATTTACTGGATTTTTGTGCATAAGACCTATTACAAAATTTATGTGTCCAGAGA
CTGTATCCAATAATGTGTCGATAGTTGTATGGAAGTGGGCTGAAGATGTGGTAGTAGTAGAACCTAAGCC
TTTACTTTCAGGACCAACGCAAGTGTTTCAACCACCTGTAACATCTGCAGATTCTATCAATACCATAGAT
GCTTCAATGCAAATTAACTTAGCAAATAAAGCTGATGAAAATGTAGTTACATTCTTTGATTCTGATGATG
CTGAAGAAAGGAACATGGAAGCATTATTGAAAGGAAGTGGTGAACAAATCATGAATTTGAGATCCTTACT
AAGAACGTTTAGGACCATATCAGAAAATTGGAATTTACCACCTAACACAAAAACAGCAATAACAGATTTG
ACTGACGTTGCGGATAAAGAAGGTAGGGATTATATGTCTTATTTATCATACATCTATAGATTCTATAGAG
GAGGGAGAAGATATAAGTTTTTCAATACAACAGCTTTGAAACAATCTCAAACTTGCTATGTTCGTAGCTT
CTTAATACCGCGATATTATACTGCTGATAACACAAACAACGATGGACCTTCACATATAACATATCCAGTT
CTTAATCCAGTTCATGAAGTAGAAGTACCATACTATTGTCAATATAGGAAATTACCAGTAGCATCTACAA
CCGACAAAGGGTATGATGCATCTTTGATGTATTATTCTAATGTTGGTACCAATCAAATTGTTGCTCGAGC
TGGTAATGATGATTTCACTTTTGGATGGCTCATAGGAACACCGCAAACTCAAGGAATAACGAGAACGGAA
ACTAAATAAATGAATGAAGATGTACTTTAGAGGACAGACATACCCTCTTTTGTATGGCTATAGTCTAAAT
TTTTCAGATAATTTCAATTTGGACCGAAAAACCGAGCAATAGGAGCACTATGGTTCGAGAAGACATTATA
AGACAAACTCACTAGATGGAGGGCTTATAATTATAAGCTTCTTGACATAATCTAACCATTGCGTCAAAAT
TTCGAATTAGTAAATTAAAAAAAAAAAAAAAAAAAAA