Black queen cell virus, complete genome.

NCBI Accession No: NC_003784

META_INFO
VOUCHER_INFO NCBI_Accession : NC_003784
DESCRIPTION Black queen cell virus, complete genome.
SOURCE  
ORGANISM Black queen cell virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Dicistroviridae; Cripavirus.
CITATION I  
STATUS published
TITLE Leat,N., Ball,B., Govan,V. and Davison,S. Analysis of the complete genome sequence of black queen-cell virus, a picorna-like virus of honey bees. J. Gen. Virol. 81 (Pt 8), 2111-2119 (2000).
CITATION II  
STATUS Direct Submission
TITLE Submitted (04-MAY-2002) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA
CITATION III  
STATUS Published
PUBMED_ID direct submission
TITLE Leat,N. and Davison,S. Submitted (06-SEP-1999) Microbiology, University of Western Cape, Modderdam Rd., Cape Town, Western Cape 7535, South Africa
ANNOTATION  
COMPLETE_SEQ 1..8550
SOURCE
MOL_TYPE genomic RNA
DB_XREF taxon: GeneID:944341
COLLECTED_FROM
SEQUENCE
>gi|20451021|ref|NC_003784.1|Blackqueencellvirus,completegenomeCGCAAAA
TTGCGTATAGTATATAAAATACTATACGCGCTTGGTTGTTTTCACATATCAAGTGGGTTAAAAGCCCCGT
ATGCTTGGAGACCAGGTTTGTTTGCCGACTTACGGAATGTCGTTAAACTCTAGGCTTTCCGGATGGCTTC
TAATTATCCGAGGCCCGTACGTGGGCTCGAAGTTTAGTAGAGAGTACGCGTACAAAAGTCCTAGTTGTTT
TCATACATCAAGTGGGTTAAAAGCCCCGTGTACTTGGAGGCTAGGCAACACGATTACAGTAGCCTGTACT
ACCTGAAGCATGTAGTAAAACTGCACAGTTGAAAATTGTCACAAACGGGCTGAAAGCGTAGGGCTGGATT
GTTGAGGGATAGCATTCTGCGGGATGTGAAAGAACATGTTAGACATGTATTATGGTTTTTCCCAATACGC
AGTCTTTGCTGTGCGTGTGTAGGCAAAAGGAAGTGAGAGAGCTGACCGTCTCTCATGGGTATCTAGGTTA
TTCAGAGTACGCTGCTACTGCGGTAGCGGACACAACCCAGGTGTTCGGGTCTCTGTCTTAGAACTATTAT
TGATGGCGAAAGTTGTTAATGGGCTCTCTAACGTCACTCTTAAATGGTACGTGTCGATTGAGTTTATTGC
AATGAATAGCCAACCCTATAATGATGGAACCAATTTACGAGAATACTAAAACTGTAACTGAACCAATACT
TTACTACCCATTCCGTTACAACTGGAATATTAAGATTCTTGACCTCACAGATAAGGAGGGTCAAGAGAGT
GTCAATAAGAAGTTTTTAAGGAAGTTTACTAAACTTAGGAAGCTTTGTTTGAGACTTCAAAAGGACACTG
CCTTCTGGAAAAATACTAGAAGTAGGTTAGATATGATTCAGGATGACATAGACAAAATGGTCGCACAAAG
TGGCCCTGTTATGAGTCAGAGCTTAAGTGACAGGGTTGACCGCATGTACCATGAGTTAATACATACGAAT
GTCGCTCAAATGAATTTCTCTATACCGTTTTCACATAATTTGTCCAAGGATTCAAAGGCGTTTCTTACTC
AAACAGTAGACACTTCTCTTGATGGTATGAAGCAGATTTCTAATGAAACAGTGAATACCATTAAGGAAGT
GTTCGAAACGTTTTTGACTAAAATGACGACTACATTTGAACAATGTGCAGAAGCTCATTGTAAAATTAAA
AGCTTCTGCACATTGTTCAAATGTAGTCGTCATTTTAACAATGTGCAGGAAGCTTTTAATTTTACAATGA
GCTTTATGAGATTTTTAGCTTTGGCTTATGCCATCTTTTTCCTCATTTCACGAGCAACTAAGTTCTTTGG
AGCGTCATTTTCTACGATATCTACTGTTCTGATAACTCTTATTACTATGACAGTAACTGACAAGTTAGTT
AAGAAATTTTTGGTCGATTACTACTCAAAACACATGGAAAATGCTAAAATGTTAGCCCAAGCAGGAGAGG
AAGACTCGTCTTTTCTATCCTACGTCATTCCCCCATTGTTTTTAGAATCAGTTGTAGATACAAAATCTAA
CTTGTTTAAGAGGATTTGGAAGAGTAAAGACCTGGACCTTGTTGTTAAGAGGTTGTCGTATTTTGGTGAT
GCTAAAATATACAATGCCTTTGACAATATAGGCACGTGGTTGACTACGATGATCAACAAGACAGTAAATT
ATGTAAAGGTTACACTCTTGGGCCATGATCCTGAAGAATTTTTGGAGAATCAGAGTGACCCTCTGGTGGA
TTGGGAAGAGCAGTGCAGGAAACATTTCGTTTCAGACACTGATAGAATAGCGATCTATACAGAGTCCACG
TTAGCGGACATTAAACGTCTGTACAATATGGGCGTTAGTTATATGCGGCATCCTCTGTATAAACCCCACC
AGCGTGTTATTTCTGAGATTCTGAATCAGTTACTCAGGTTTGCTGATAAGATCAAAAAGAAGGTAGGCAC
GGATGCTTCTGTTCGAAATCCCCCAGTTACTCTATATTTATATGGAGAAACAGGAGTAGGTAAATCTACT
TTGACGTATCCTTTGTGTGCCACTCTTCTTAAAACCATCTTTACAAGAGAGGGGAATACAGTGATGCTTG
AATCTCTTAAACAACATTACAAAGAGATGATATACGTGAGAGCTGCAGAACAAGAGTTCTGGGACGGCTA
CACGCAGCAATTAGTCACTGTATTTGATGATTTCAATCAGCAAGTTGATTCTTCCGCAAACCCAAGTTTG
GAGTTATTTGAAATTATTAGGAGTTCTAATATATTTCCTTATCCATTACACATGGCATCGATTGAAGAGA
AGGCTAATACCGTTTTTCAATCAAAGGTGATATTGTGTTCTTCTAATAATAAGACTCCAAAAACTGAATC
TCTAAATTATCCGAAGGCTTTGTTAAGAAGGTTCGCGAAATTCGTCGAAGTTAAGAGGGCTCCTTCTGAA
AGTGGTACATTCTCTACTGATTGTTATACTTTCGTGGAATATGATCCATTTGACCACTGCAACATCGTTA
AATCAATGTCTTTCAATGAATTGATAGATGAGGTGGTTGCCATGTATTTCCACGAAGGAGAGTTTGTATC
TTCCGTAGATAAATTTATTATGGAGAATGTATTTGCTCAGGGAGGAGGCTCTTTATCAGACGAAGAAGAT
GATTTTATTGAAGCTAGTTCTTATGGTGACAGTAATCTGGATGAAGCCTTGACACGTGAAGAAAAGAAAG
AAATTATTGAGTGTATCAACGATCAATTTAAGAATGAGAATGATACTAGAACTTCCTTCCAGTTGATTAG
AGACTATTTCCATTGTGCTAAGGACTCGTTACAAGAGAAATTTTTAGCTTATCGCCGAAAGTACTCTTTC
GACGATTGGTTTAGTTTCTCAAAAGCGTCCAAAGTAGTATTGGGAATACTTTCTCTCGTATTGGTTGGGT
ATGGCATATATTCATATGTCAAAGGAAATCCTGCAAAAGACTCAGCTGAATCCTACGAGCCAAAGGTGGC
GAGTAAGGCCAAGGTTGAGGGAAGTAATGGCGTTCCCGAGGCATATGAATCTAAAGTCAACAGAAAGATC
AATGTTGAAGGGTATAATGCGAGAGATCTTAAGCGTAAAGTAGAGGCTTATGCTCCTAAAGTTAATCGAA
CTGTGCGCGTGGAATCTAGTGAGGTGATAATACATCCTAATTCTCTGATCGAGAAAGGTGATGATATTGT
ACAGTCTGAAGCATGTAGCGATATAAATGCTTCGGAACAACTCACTGCTGTTACGACTAATAACACCTAT
GTAATGACTATCTTATCTAAAGAATCTGTTATTAGAGTGGGGCACTGCATTTTTCTGAAAGGAAAGATTG
CAGTAGCTCCTGGTCATTATCTTCGTATACTCCAACGCGCATATGAGTTAGATGACGGTGCTATTTTACA
ATTTAATCATCCTTACGGTAAGAGAAACTTCTTTACGTTTATCGGTGATATCCAGTTCTCGTTGTATAAA
ACGAAAAATATATCCAAAACGAACGATTTGGATTCTCGTGACTTGATGCATTTTGTTGTTGATAAGTCAG
TAGTTCACAGAGATATTTCTTCGTATTTCTGTGAACGTTTAGAACTGCAATCTGTTGGTTCTACTCGAAT
CCAATTACCTGTTATGCGATGGGTAAGAGATGTTGGATATATTTTCGTTAAGTCGGGACAAGGTACTAGT
TGTATAAAGAACGTTTCCAACGTTAGTTATATGACTGATACTGATCCCGACGCTCGAGAAATTCGATTGA
GGGAAGCATGGGAGTATTCTTTAGAAACAATATCTGGTGATTGCGGAGCTCCCCTTTTTGTAACCAATAG
TAAAATAGGACCTGGTAAAATTATAGGAATTCACACAGCTGGGGGTCATCGATTCGGAGTTGGCAGTTGC
TTTGCCACTCCGTTTTACTTAGAGGACGTGAAAGAGATCTTGTCTCGGTACGATTATAAAGCACAGTCTT
GTGCTTTTGAGTTAGTATTGCGACAGGATCTTGAACCATGTGCTCTACCTAACCACTTGGATGAATGCGA
ATTCATCTTGATGGGAAAGGTAAAGGATCCTCCAGTTCAACCATCTAGAAGTAAAATATCTCCATCTCCC
TTGTACGGACACATAACTGAACCCTCTAGTGCCCCAACTTGGTTATATCCTAGGGAGCTTGATGGACAGA
TTTTTGACCCTTTAAAATATAGAACTGCTAGACTTGGAAAAGATAGCGTTCCTATTAGAAGTAAGTTAAT
TAATCTGGCCAAAATGGCTCTTATAGATGATATATATTCCGTGTACTTGCAAAAGAAAGATCTTTTGGAC
GGACGATTTCCATCATCGTTGACCTTTGATCAAGCAGTGTTGGGGATACCTGGAGAAGACTATGTCAATT
CAATAAAACGTGATACCTCTTGCGGTTATCCTTTCGTTAAGGAAGGATGGACACGAGCTAAAATCTTCGG
TAACGGTGATGAATATGACATGTCTACCTCGGGTGTTCAAATGTTACGAGAGAAAGTACAGGAATGCATA
GAGGCGGCGAGACAAGGGAAGATATTGGACCATTATTTTATAGATACATTAAAGGACGAAAGGAAGCCTA
AACATAAGGCTCATAAGTCTCGAATGTTTTCTAATGGACCAATAGATTATCTTGTTTGGAGTAAGATGTA
TTTTAATCCGATAGTAGCGGTGTTGTCTGAGCTTAAAAATGTAGACCATATTTCCGTGGGGTCCAATGTG
TATTCTACGGACTGGGACGTTATTGCAAGGTACTTGAAGTCGAAATCTCACCATATGGTGGCTGGAGACT
TCGAGGGCTTTGATGCTTCGGAACAGTCCGACATATTGTACGCTGCGGGAGAGGTTCTGCAAGAGTTGAG
TAAGAAAATCTTTAACTCAACTGAGGATGAGATGTTGCAACAGAGGGCTATCATCCACTCGTTGGTCAAT
TCACTTCATATCAATGAGAACGGGATTGTTCTTCAATGGTGCAAGTCTCTTCCTAGTGGCCATTATCTCA
CCGCTATTATTAATTCCGTCTTTGTGAATTTGGTTATGTGTCTTGTATTTATGGAAGCCAATCAAAAATA
TTCATTTACGACTGCTTCTTCATTTTTCCGTGAATGTGGTATAGTAGCATATGGAGACGACCATGTTGTC
TCTGTTCCCGAAAAATACTTGTCTGTGTTTAATCAACAGACACTACCAGTGTTGATGAGTAAATTCGGGA
TGTTCTATACCATAGAAACCAAGGATGACACAGAGATTGATTTCCTTTCGAGGAGATTAGAGGATGTGTC
GTACTTGAAACGGAATTTTGTTTATGACGAATCTAGGCAACGTTATATTGCTCCTCTCTCTTTGGATGTT
GTATTGGAAATGCCTATGTGGACCAAATCCAGCAAGGACATTGTAACTAATGTATTCTGTAATTTGGAAC
ACGCCCTCAAGGAGTTATCATTGCATGATAAAGAATTGTGGGAAAAATGGAGTCCTGTATTGCATTCAAA
GAGTGAGGAAGTCCTGAAAATGGTTTCTTCTCTGAAATTTCAAGATGAGGTCAGGGAGATTGCTCTTGGC
CTTTCAGGTTATGAGTAGTTTTCTTGACTTCTCTTAAAACCAACAATGTGATCTTGCTTGCGGAGGCAAA
ATTTGCACAGTATAAAATCTGCAAGTAGTGCTATTGTTGGAATCACCGTACCTATTTAGGTTTACGCTCC
AAGATCGGTGGATAGCAGCCCTATCAATATCTAGGAGAACTGTGCTATGTTTAGAAGATTAGGTAGTCTC
TAAACAGAACAATTTACCTGCTGAACAAATTAATGAAAATTATGAAAATAAACAACAACTTGTTGAACAG
ACTGAAATTACCACCTTTGAAAACGATTTGATAGTGCTTGAAGATGGACCGCAGATGGAAGAACCTCTTC
CTTATGCATTCCATGGACAGCATACTGATAATCGTCAACATACGGTGGTTAATTTCTTGCAACGTCCCCA
GGTTATTTTCGATTCGTCTTGGGCGTCTGATCTCCCTCGAAACAAACAATTTATGGATTCGATTATGATA
CCAGATGATATCATTTCTTTTCCAATGTTTGCGGAAAAACTCAAAGGATTTTCTTCTTTGAGAGCAACAG
CTGTAATAACAGTGCAATTTCAGACGCAACCATTTCAAGCGGGAAGGGTCATGTTGGGATCATTTCCATT
ACCAACACTCAACCCAACTAGAGTTAAGTTTGCCACCAATCATGTGTCTCGTTTAATGCTTTTAAACCAT
GTCCAGTGTGATATTGCCAAGGAAACTGAAGTATCCTTACGGATTCCTTTTGTTTCTCCATACAATTCAT
ACGACTTGGTGTCGAAGCGTTTTCCGTGGGCTAAAGTGGTTGGTTTGGTGTACTCACCTCTTACTACGAC
CATTCCCGTAGATTATATAGTATACGGTCATTTTGAGGACGTGGAGTTGGGTTGTCCAACTTCAGGAATG
TTGGCTCAAGCAGGTCTTAAAGTGCAACCTCCTACGAACTCTGACTCTCGACAGCGTGCCAAAGAGAGTA
AGGGAAAGAAGGATTACTCTAAGACAGGCGCAGCTTTTAAACAATCTGTTTCAAAGCTGGGCGAACATTT
ACCTTTCCTCAAATCTGGAGCGAACTGGGTCAGTGAGAACATTCTACAACCTGCAGATGAAATCATAGGA
CCTATTTTATCTCTTTTTGGGTTCTCGAAGCCCCTTTTGCCCATTACCAATCCCACCGTTTTACGGCCAG
CGAATACCTTTGCTATCACTGATACAAATGATATGTCGCATAGTCTGGCGCTTTCTAATGATACCAATGT
ACCATTTGTTAAGGCGCTGGATGGTTCTGGTTTGGACGAAATGAGCTTCGATTACCTGAAGAAGATACCC
CAATTCATACAGTCAAAATTCTTCACCACCACGACAAAACCTCAAGAGGTTTTGTTTCAGACTAAAGTAA
TGCCTCATTACTTTGTCCCGGCTGGCGATGTAACTGTCGCCATGGATAAAGATAAAACTAGAACTATTTG
GCAACCTAGCCATTTAGCCTATATCACTTCCATGTTTAAGTATTGGACGGGTTCGCTCGTGTATACATTC
AAATTTGTTAAAACAGACTACCATTCTGGTAGGGTGGAGATTTCTTTCCACCCTTTTTCTGATTATACCG
CTAACTCCTATTCGGATTATACCTATAGGATTATAGTGGATTTGAGGGAAAAGTCTGAGTTTTCGGTTAC
AATACCCTTCATTTCTCCAGTACCATACAAACGCATATCTAGGCCAGATTGGGATAAACCTTATTCCAAG
TACGCTCATGCTAGTACAGGAACTCTGGTGTTGAAGGCGTTGACATCGTTAAAGGCGACTAATACCGTGG
TTTCCAATTCTGTGGAAATCTTGATAGAAGTCAATGCTGGCGACGATTTCAACGTTATCGCTCCTATCGA
AAACATCTTCTTCCCCTTCTCTCTCTCTCCAGGGAGGAAGGGGATGGTTGCTCAATCCAATTCGGGGACT
GAACAACAAAACCCCAGAGGATCATCTTTGTTAACTGATCCAGAATCTATTACAAAGTCTGATCCTTACA
ATCCGAATATTTCTCTCTTGATTAGTGGAGAAGTTTTCACGAACTTCAGAAATTTGATCAAGAGGGTAAA
TTTCAGAAAGGCTACTACGTTGAATGGAAAACGTATCTCAGATACGTTTGACATCAACAGCCTGATTGAA
GCACCCCGTCTTGATATAGCGCAATATGTCGATACTGAAACAAAGGAGGCTAAATATGGATTTAGCTACT
TTTGGTCAGCTCCCACTACCTTAAACATAGTGGCGGAGATGTATGCGCTTTATCGAGGAGGAGTTCGAGT
TAAAGTAGTTACTGAGAAGGGTGTAGATTTCGTCAGAGCTACCGTTAGTCCTCAACAGACTTATGGTAGC
GATGTCGCTCCTACTACTCACATCAGTACTCCTTTGGCAATAGAACAAATACCTATAAAGGGAGTCGCAG
AGTTCCAAATACCGTACTATGCTCCATGTTTGTCATCTTCGTTTAGAGCGAATTCGGAAACATTTTACTA
TAGTTCAGGTCGGAATAATCTCGATATAGCCACTTCACCTCCCACCGTCAATCGCTATTATGCGGTTGGT
GCGGGAGATGATATGGACTTTTCCATCTTTATCGGTACGCCGCCCTGTATTCATGCATCTCAGACGGCCC
AGTTTACCAAGATAAAACAAGGTAAAGTGTATGATTTGAGGTATGATCAGTACGACCCTTTTAGGGAAGT
CCAGGACGGTACGGCGTTCCTCAATGCTCGTAGTATTGAGGATAGCGATTTGTTGTGAGCTCCTTTAGAG
GGAGGGCTCACTTTATCTATTGCTTAATTCGGTAAGCCACAAATTTTTCTAAGTGTCATGAGTTTCTTCT
CGGTTCTTCTCATGATTACTAATCGAACCGTGTGTAGAGTCAGAATGTTGTGGTTTACGTTTCTTCTTGT
TGC