Kashmir bee virus, complete genome.

NCBI Accession No: NC_004807

META_INFO
VOUCHER_INFO NCBI_Accession : NC_004807
DESCRIPTION Kashmir bee virus, complete genome.
SOURCE  
ORGANISM Kashmir bee virus
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Dicistroviridae; Aparavirus.
CITATION I  
STATUS published
TITLE de Miranda,J.R., Drebot,M., Tyler,S., Shen,M., Cameron,C.E., Stoltz,D.B. and Camazine,S.M. Complete nucleotide sequence of Kashmir bee virus and comparison with acute bee paralysis virus. J. Gen. Virol. 85 (PT 8), 2263-2270 (2004).
CITATION II  
STATUS Direct Submission
TITLE Submitted (16-MAY-2003) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA
CITATION III  
STATUS Published
PUBMED_ID direct submission
TITLE Submitted (14-APR-2003) Entomology, Penn State University, 548 ASI Building, State College, PA 16802, USA
ANNOTATION  
COMPLETE_SEQ 1..9524
SOURCE
MOL_TYPE genomic RNA
DB_XREF taxon: GI:30793780
COLLECTED_FROM USA
SEQUENCE
>gi|30793779|ref|NC_004807.1|Kashmirbeevirus,completegenomeTACGTACAATT
TTGACGCTTCGTTCATGCAACAATGAACTCACATGTGGCGCTCGGTAGTAACCAGAGGGGCGTCATTCCC
CCGTATGGAGTGGAGAATATAAGCTACCGACTCGAGCTGTAGAATAATTCAGCAACTTATAACGAACACG
AATTTTAGTCGACGAAACCATTTTAGCCTTTAATTCTATGATTTGATTATAATGATAAACAGCTCATGTA
ACTGTCTAAACTACATAAATACAACTGGATTACGAACCTTTAAGTAACTATCTTAGATGAAGTCTAGTAG
TCTCCCAATATTTCCGTGAAAAGAATGAGGGACGAGATAGCTCTATTTAAAGACGTGAGGCTTTAAATTC
TGATAAATACATTACCTGAGAATTCCTCCTTTAGGAGTTAGAATTTGAAAAGATTAGTACCTATACTTAA
TAGAATTTAAATATGTTAATAATGCTGAAGACAAGTATTTCGATTATTAACCTCTATATTTCTATATAAA
GTATCTGTGAGTCTCAGTGGACATCACAGTAAGGTCGCAGTTAACTTGTAATCTTTTCATTCCTGTGTCG
GAGCAGTGGTAATGGAGCCGGACGATTTCGCCAAAACATGTTTTCTTCAACTCAACAAAATAACAAGATG
ACAAAACAACCAGCAACTTTAACCTATCTTTCAAGTATGAAGGTGATTAGTATGCCACCAAGTGAATTCT
TTTCACTTGATGACTTGTGTCGCCAACAAATTTTAAAGATGGTTTATATTGACCAATACGCTTTTCACAT
GTTACATGAAGACATAAATTGTATAGGGTTTACTCTATCAATTTATGATGAAGATAAACGAATGAAGGAC
ATAACTTATTGGGATCTGAATTGTGAATATCATGAAAATTTATATGATGCACTAATGTCGGCCGAATTTG
AACAAGTTTGGTTTACATTATTGCTTAAATATCTTGATTTTGTACCAGTACCAATGAATTGGAGAGGAAT
GCCAGAATTTCCTACCATTTATGTATCAAAACATTTTTGGTATGAATTATATCGCATTGGATTTTTGAAT
AAGTTATATAAATGTGGAACTTGGGAGTCAGTATTAAATCTCTTAGCCGGAGATATAGAATTGAATCCTG
GACCCACTGATATTTCTTACAAAGAACAATGCCAACGACGACAACGACGCAAACGAATTTCTAAATCTTA
TGAAGAAATCAAAATGCAACAACATATTGATAAAGTAATAAGAGAAGAATTTCGTTCCCACCAGACAAAA
CCCAAGAAATTGAAAGATGTTATTGATGTTTCTATGCAGGGACTTTTTAATTTTCAAGAAGAAAAGGATA
TTATTAAGTCAACTGCATATAAATTCAATGATACTCTGGATAAATCTAATCATATAATGGATAATCTTAT
ACCACAATTAGAAGAAACGTTAGCAGGCTTTAGAAGGACTTATGCGAAGTGTGAACAAAAGTTATTTGGA
ACTATTAGCATTATTGATGTCTGTATTGATATCATTAGTGCTTTGTTACAAGTAAGTTTTGCGAAAGCTT
CAATGAAGTTAGCTTCTTTAGCAGTAGAAGTATTTAGATTAATTAAGAAGTATGTAGGCAGTGTTAAGAT
TAATATTGATAAAATAAAGGAGTTGTTAACATTTGGTAAGCAAGCATTAGACGTGGATAATCCCATTATT
CAAGTTAAAATGCAAATTGATATGCCAGATTACACAACTCTTTTACAACCCAATGTTATTGTTAGTGCTA
TATTTTTAGTATTAAGTGTTATTTTCACCAGAACTCTTCCCACAAAAACTGGAATGGAAGCAATGATAAA
AAGGATTGGAGATCTAGGACGTGCTGCGAAAGGCGTTTCTGATCTTAATTCTGTTTTGAATAATTCCATT
TCAACTATGTTGGAACATTTTGGCGTTCATACTTTAGGTTTAAAACAAGAGGCAGAGCTTCAACTTTTAG
TACAAGGCTATAAGGCCTGGTGCGATGAAGTGAGAGCTCTAGTAGGACATAAGATTAAATTAGACGGAGA
TTTTGATGGAAAAAGTATTGTTGAAGAAATAATGAAAGATGTCCACGAAATTCAGCGTGTAGAGAACCTC
TACAAGCAAGGATTGGACATTGCTCGTAATATTTCTGATATGAAACTCCCATCAAAATTGACAATTAGTT
TTAATACCCACATGAGATATTTGACTGAAGTTTTCAAAGCAGTAGACACCTCTGGCGCCTTTGGAAACAA
ACCACGGACTCAACCTGTAGTCATTTGGCTATATGGTGAGAGTGGACGTGGTAAGTCAGGTATGACATGG
CCCTTAGCAGTAGATTTAAATAATAGTTTATTAGATGATGTGACGGAGATGCGTAACTTTTCCAAGAATA
TCTACATGAGAAATGTAGAACAGGAATTTTGGGATAATTATCAAGGACAAAATATCGTAGTTTACGATGA
TTTTGGACAAATGAGAGATTCAACAGCTAACCCAAACCCAGAATTCATGGAATTGATACGTACTGCCAAT
ATCGCCCCCTATCCTCTACACATGGCCCATTTGGAAGATAAGAGAAAGACGAAGTTTACGTCGAAAGTGA
TAATCATGACATCCAATGTTTTTGAACAATCTGTAAATTCGCTTACTTTTCCTGATGCTTTCAGACGCAG
AGTAGATCTGTGTGCTGAAGTGCGCAATAAGGAAGAATATACGAAGGAAGGTTATTCTAAGCAGAAGGGA
TGCATGGTTAAGCGATTAGATCGTGAAAAGGTGCAGAAGTTGACAGGAGATATTCACTCAACGAAACCAT
ATTTGGTTGACTTAGTGAATGCAGAGACCGGAGAAAAATATAAGACTGACATTGAATATGAAGACTTTTT
AGATATGTGCTTGGAGAAAACCAAGACGTGTCGAGATGAGTCTGCCAAACTCAATGAATTTCTTATGAAT
TATGCTGAACAACGCAAAGACAGAAGTAGAGATACTTTTATCCATCCTGAACCTGAATATGACGATGATG
AGTTCAAGGACACATTAGAAGTACAGATGCAAATTGATGCTCCTAATGATGACCTTGTTCTCATTGAACA
AGATAGATTGCGAGAGATGATTGATTCATGTACCGGTGTTGTTTATGATTGCAAACAACAAGTAGTGAAG
ATATCAAAACTCGCTTTTGATCTTGCCCCATTAGACTATGATGAACAAATGCAACGAATTAAGGAAATGA
AGTATTACCAGAAAGTCGCAAGTGGCGTATCATATTTGAAGAAAGTTTTGGATGCAGGTCTTGCAATTTG
CAAGACTTGGATTGAAGAAACTGTCAAATATGTGCAGGAACACCCTTGGACCACAGCAATGGCCATTTTA
GGAACCCTATTAGGTATTCTTACCGTAGTAGGATTTTGGAAATGGCTTTGCAGTGGAGAAAAGAAGAAAC
CACAAGCTACAAAACGACATTTTGTCAATACTGGTGTGACTCTTGTCATACCACATCGAGACCTCAATAA
GTTTTGGCAGTTGGATGAAACATTAGACGTATCCAACATGCGTGTTGGAGATGTTGAAGATCATCTGGCG
GCCTTACTTAAACCCAGACATCGTGTTGTCATTGTACCTAGGGTGACTAAATTCATTTTGAGTATTATTG
ATAACCACTCGAAACTCTTTGATAAAACGATTTTAATTACCAAGAACCGATTCTTTACTTATGAAAATAA
ATATATTGAATTGGTGTGTGGTGAGATGAATCGTTTCTTTGAAGAAGACCCGGAATCACTTGTAAATACA
CCAAAAGTAGAAGCTTTTGCTTCTGCTGATTTGGCTACTTATAAAAACAGGACTCCGATAGTTATTGAGG
CACAAACATCAGGAGATAATATGACTCTTAAACAACCACGACCAGTTGTTATAGAAGCTCAGACATCTGC
TGATTGTGTTACTTTAGCTAAAAACACACAACGAATGATTGAAGCATTTGCAAGTTCTGATACTGTAACA
CTGAAAAGACCAACAACAAAATATGTTGAAGGAACTGGATATGATACAGTTGATGTCTCTATGCAAATGT
GGAGAGATCAGGTGGCGCAGAAATTGATCACTAACCGAATTTTAACAAATCTGTATAAAATTTGTTTAGT
AAATGACGACGACACAGTAACACCACTTTTGAACGGATTATTTATTCGTTCAAATGTGATGTTAGTACCC
GGACATTTGACTGGATTCATTGCAGAGCATGATACAATTGAAATCAGAAATCTTTTTGATGTGGTATTTA
GAGTACCATGGAAAGAAGTTAAGAAGATAACAGTTGAGAATGCTCTTGGTGAATCCAAGGAAGCAGCGTT
ATTAGCGTTCCCTAAGTTCGTATGTCAACACTCTGACATTGTAAAGCACTTTCAAACTGCTGAATCAATG
TCAAAGTTTAAGCGATGTGAGGTCACATTACCTGTATTGCGTTACTCTCAAAAATTGGAAAGATTTATGT
CTTCCCTTATTGAATGTGATAAAGTAGAGGCATGTGATAAAACTTATACGCTAAATGATGTTAAGAAAGG
ACAATATATATTGCGACAAGGATTAGAATATACGATGCCGACAATTGATGGTGATTGTGGAGCCCCACTA
ATCATCAATGAAACACAGGTTACTAGAAAGATAGCTGGTATACATGTTGCTGGTGCAGCATGTGGTCGAG
CTTATGCAGAATCTATAACCCAAAAAGATTTGGAGCGTACATTTAGTAAAATAGATGTTACGATGCAAAT
CCAATTGGATTTAGATTCTTCATTAGATTTTTCTAGAACCGAACCCAAAATTCCTGCTGGAGTCGAATTT
GGACCGGAAGCTCTCACTTTTTGTGATCTTCCAGCCCTTAAGATGATACCAGTAGGACGACTTCCCGAAC
CCCTATTTGAACCAGGCAAAACAGATATTAGGCCTTCCTTAGTACATGGAATGATTTCTGATATTAAGAC
TAAACCAGCTTACTTACGTAATGTAAGAGTAGATGGTGAAGTTATAAATATGAAACACAGAAATTTAATG
AAATGTGCTATGGATACACCTTATATCGACAAGGACATGATCGAGGAAGCATATCAGTTAACTAAATCCG
TTTGGTTAAAAGGTATGCGAGATGAATTGAAAAAGGTTCTCACTTATGAAGAAGCCATTTGTGGCTCTGA
AGTAAGTGAATACATTTCTTCAATTAATAGGAGTAGCTCCCCAGGATATCCTTGGATAAAGGATAGAGTG
AAAGGAACTAAAGGAAAACAAGGCTGGTTTGGTACTGATGGAGAATTTATTCTCAACGAAGATGTCGAAT
TAGCCGTACAACGACGACTACAAGCAGCTCGTGAAGGAAAACGATTACCTGTGATGTGGGTCGACACATT
GAAAGATGAACGTCGACCTATTGAAAAAGTTAATCAATTGAAAACACGAGTATTCTCAAATGGACCAATG
GACTTCTCAATTGCGTTTCGAATGTATTATTTGGGCTTTATAGCTCATTTGATGGAAAATCGAATTACGA
ATGAAGTGTCTATTGGAACGAATGTTTACTCACAAGACTGGAGTAAAACTGTTAGGAAATTAACCAAATT
TGGAAATAAAGTAATTGCTGGTGATTTTTCAACTTTTGATGGATCACTAAACGTTTGCATTATGGAAAAA
TTTGCAGATTTAGCTAATGAGTTTTACGATGACGGACCGGAAAATGCTTTGATACGTCATGTTCTATTGA
TGGATGTGTACAATTCTGTACATGTCTGTAATGATTCAGTATACATGATGACTCATAGCCAACCTTCAGG
AAACCCCGCAACAACACCCCTTAACTGTTTCATTAATAGCATGGGATTGAGAATGTGTTTCTCAATTTGT
GCTACTAAAGCAGCGGTTAAAATGACGATGAGAGATTTTAGTAAACATGTTTCCCTCGTCTCTTATGGAG
ATGATAATGTAATTAACTTCAGTGATGAAGTTAGTGCATGGTATAACATGTCTACTATTGCAGAGGCTTT
TTCAACACTTGGATTCACTTATACAGATGAGCTCAAGGGAGTTAGAGGCGAGGTACCAAATTGGCGATCA
ATACAGGACGTGCAATATCTTAAACGTAAGTTTAGATATGACAATCAACGGAAAGTTTGGGAAGCTCCAT
TGTGTATGGACACGATTCTTGAAATGCCTAATTGGTGTCGAGGAGGACTCGATATTCAAGAAGGTACAAA
ATTGAACTGTGAAAATGCAATAATGGAACTTTCTATGCATGAAGAGGAAGTCTTTGATAAGTGGTCAAAA
GTAATTGACAAAGCTTATGCAAAGGCTACAGGAGATCACCTGGACATAAACACTTATCGTGGATATGCTC
AGGAGCGGTATCTCGAGTATTATATGTAAATATAATACTTGAGATGCACTGTTTCATGGTTACCCATCAT
TTGAGGAAATTTCCAATAAACTTGAATGTAAGGCTTGAAACAGTGGTCTAGGTGCCCTATTTAGGGTGAG
GAGCCTAGCTGGCAGCCCCAGTGAATCCTCTATTGGATAGAAACCGCTATATCGGGTAGCTATAGCAGTC
GGATAGTAATATATCCGGCGTTTCGAAATACCATACCTGCTGATAACCAAGAAAACGATTCTACCAATGT
ACATAACACGAAACTCGCGTCGACCTCAGCGGAGAATGCCATTGAGAAGGAACAAATCACCACCTTTCAT
GATGTGGAAACTCCAAATAGGATCGATACCCCCATGGCTCAGGATACTTCATCGGCTAGGAGCATGGATG
ATACGCACAGTATTATTCAGTTTCTACAACGCCCCGTTCTCATTGACAACATTGAGATTGTTGCAGGAAC
AACTGCCGATAACAACACAGCACTCAGTAGATATGTGCTAGATAGAACAAACCCGCAAAAATACATTAAA
CAATGGACATTACCATCAACAGTGTTGAAAGCTGGTGGAAAAGCCCAAAAGCTTGCCAACTTTAAATATT
TGCGATGTGATGTACAAGTGAAAATTGTATTGAATGCTAATCCATTCATTGCTGGTAGGTTATACCTAGC
ATATTCACCTTATGACGACAAAGTAGCACCTGAACGTAGAATTATTTATACTTCCCGTGCAGGTGTTACA
GGTTATCCGGGAGTCGAACTAGATTTCCAATTAGACAATTCAGTTGAGATGACTATTCCATATGCATCTT
TTCAAGAAGCATATGATTTAGTTAGTGGGAATGAAGATTTTGTGCAGTTGTACCTTTTTACAATTGCACC
GGTTTTGGGACCTTCAGCTGAATCAGCGAATTCAAAAGTAGACCTTTCAGTCTATATGTGGTTAGATAAC
ATATCTCTCGTTATCCCCACATATAGATTGAATCCAAATCTTCCAACCGGACAAACTCTAACCCGCATAG
TTCAGAATTCCGATTCTGATAAACTCAAAGAAGCACTTAAGATTGCTAAGTCTAAGAACCCTTCAGGATA
TAAATATATCATGGGAGTTCTTGAACAATACAATCCAAGTGTGAAACAAGTTTCTATGCAAATCGCAACA
CCTAACAAATCAAAATCAACAAAACCAACATCCGAAAACCCAAAAATTGGACCAATTTCCGAAGTGGCTT
CAGGAGTTAAGACAGCTGCAAATGGCATCGAGCGCATTCCAGTGCTAGGTGAAATTGCAAAGCCGGTAAC
TGCTGCAGTTAAATGGTTTGCTGATATTGTAGGAGGTGTAGCAGCCATATTCGGGTGGTCCAAACCCCGA
AATCAGAATCAAGTGATGCCTTATCAGAATGTGCCTGGATGGGGATATTCCCTATATAAAGGCATTGACA
TGAGTGTACCACTTGCTTATGACCCCAATAACGAATTAGGAGACTTGCGAGATGTATTTCCATCTGCCGT
AGACGAAATGGCTATTGGATATGTTTGTGGCAATCCAGCTATAAAACATGTCCTCACCTGGAGTACGACA
GATGTGGTTCAAAACCCGATAAGTAACGGAGATGATTGGGGCGGTGTAATACCAGTGGGAATGCCTTGCT
ACTCTAAGACTATTAGAGCAGTTAAAGGCGCCACTTCGACGTCAAAAACCGAAGTGATGGACCCAGCACC
GTGTGAATATGTTGCAAATCTTTTCTCATATTGGCGTGCAACTATGTGCTATCGTATTACGGTAGTAAAG
ACAGCTTTTCACACAGGCAGGTTGGAAATCTTCTTTGAACCAGGAAGTATTCCCACGGTAAGAACCGCAG
ATAACTTAGGACCAGATCAGACACAATTGAACGGAACAATAGCTCCATCCGATAACAACTATAAGTATAT
ATTAGACTTAACAAATGATACTGAGGTTACGATCAAAGTACCATATGTTTCGAATAAGATGTTTATGAAG
ACCGTTGGCATCTACGGTGCGCATGATGAGGATAATTGGAACTTTGATGAATCCTTCACCGGATTCTTGT
GCATAAGGCCAATTACTAAACTCATGGCACCTGATACGGTATCGCAGAAAGTATCTATAGTTGTATGGAA
ATGGGCAGAAGACGTAGTAGTAGTAGAACCTAAACCACTCACCTCAGGACCGACTCAAGTGTACAATCCA
CCTGCAGTAGCTAGAGACCTAGTTAAACAGATTGATGTTTCAATGCAAATTAATTTAAGTAACAAGACTG
ACGAAAACACAATCTCTTTCTTTGACTCAGGCGACCCAGAACGAATGAATAATGAGGCTCTCATGAGGGG
ATGTGGCGAACAGATAGTAAATTTAAGACCCTTACTTCGCACATTCCGAACAATAAATGATAACTGGAGT
TTGGCAGCAAACACCAAGACACCGATCACAGACCTAACAAACACCGCAGATGCTGAAGGCCGAGACTATA
TGTCTTATCTTTCTTTTCTTTATAGATTTTATCGAGGAGGTAGACGATATAAATTCTTTAACACGACCCC
CCTAAAACAATCACAAACCTGTTATGTGAGGAGTTTTCTAATTCCCCGTAACTACACAGCCGACGAAATT
AACACCGACGGACCATCTCATATTACATACCCAGTAATTAACCCAGTACATGAAGTAGAAGTTCCCTTCT
ACTCTCAGTACCGCAAAATTCCTATCGCTTCAACATCAGACAAAGGATACGATTCATCCCTCATGTATTA
CACAAATGTTGGTACCCAACAGATTGTAGCACGTGCCGGGAATGATGACTTCACCTTTGGTTGGATGATA
GGCACTCCGCAACTTCAAGGTATAACTAAAGAAGTCGCAAACTAGATGTGCATTAGGAGACAGTAAAATC
TCCTTTTGTATGGCTATTAGTCTAAATTTTTCAGAAAATTTCAGTTTAGACCGAAACAGAGTAGTACGAG
CACTATGGTTCGAAAAGACGCTTAAAAGAAATCTCACTAGAAGGAGGCTTTTAAGCTATCAGCTTTTTGA
CATAATCTAACGACTACGGCAAAATTTCGGAATTAGGATAATTTTAAAAAAAAAAAAAAAAAA