Deformed wing virus, complete genome.

NCBI Accession No: NC_004830

META_INFO
VOUCHER_INFO NCBI_Accession : NC_004830
DESCRIPTION Deformed wing virus, complete genome.
SOURCE  
ORGANISM Deformed wing virus (DWV)
CLASSIFICATION Viruses; ssRNA viruses; ssRNA positive-strand viruses, no DNA stage; Picornavirales; Iflaviridae; Iflavirus.
CITATION I  
STATUS published
TITLE Lanzi,G., de Miranda,J.R., Boniotti,M.B., Cameron,C.E., Lavazza,A., Capucci,L., Camazine,S.M. and Rossi,C. Molecular and biological characterization of deformed wing virus of honeybees (Apis mellifera L.) J. Virol. 80 (10), 4998-5009 (2006).
CITATION II  
STATUS Direct Submission
TITLE Submitted (29-JUL-2005) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA
CITATION III  
STATUS Published
PUBMED_ID direct submission
TITLE Submitted (26-JUL-2005) Rossi C., Biologia Molecolare, Istituto Zooprofilattico Sperimentale, via Bianchi 9, Brescia, 25124 I, ITALY
ANNOTATION  
COMPLETE_SEQ 1..10140
SOURCE
MOL_TYPE genomic RNA
DB_XREF taxon: GI:71480056
COLLECTED_FROM Italy
SEQUENCE
>gi|71480055|ref|NC_004830.2|Deformedwingvirus,completegenomeCGATTTATG
CCTTCCATAGCGAATTACGGTGCAACTAACAATTTTAGATAGTAGCCATGAACAAACATTATAGTAGCTC
ACTACGTATTGATCATTTTTATAATGACTTGCGTAGCATGAAGCGCATGCTTGTAGTTGTAACTATGTTA
CTTTRCAAGTTGGAGTTTACTATYTTGGATTATGAATATGTGCACTTAGTGTCTGTATTTATAGTCGTTT
GTGGTTCAAGGTTTTGTGTTAGTAGTACACTTATGTATGAATGTAYCTTTAGTATGAATGTTATAGAATG
ACAATATCGAARGAAAAATYTTTATAAAATACAAAAATATTGTTTTTATTATTTCGATATGGTGTTTTAT
AGAGTAGATTGCCATGTGACCGCTCRTAGAAGTCCATTATGGTTTATCAATCGAAGTTGAATGTATTTAT
AAGRATATTATACTTAATTAGTAATATTAGTAGTCCGTAACTATTATCATCCTTTTTCAGTTTGATGTGA
TAATAGACCACTGCAGTATCGAGTAGAGTTTCGAATGCGTAGTGCAATAGTATAATYACTGTCACCGACC
ATCTATTGTAATGATAGATCTGTCGGAAACCATTATTTATGAAGTGACTAGCAATCATGGATTAAATTAG
ATGGTATTCTAGTTTAGAGGTGATTCGGCGCTGCGGTGCGACTGAAACTTCTAAATTAGCATGTCAGATT
ATATTATGAATGCGTTAGTAGTAATTTCTGCGATAGAGCTGGGACCCCTCAGTCTCTCAGGTATTGTACG
AGGCGAAAGTGTGAAAGTTTTGTATGTGTTTTTATATGTACGACTGTATCGGGAATTCCTTTAGCAAGAA
TCCTTTTAATACAGTATAATTTGTGCTACGGTACGTTACGTTCGCAGGGCACCCGTTAATGTCTCATAGC
CCAGACGATGGCGGATGGAAAGACATCATATTTTATTTTAATGCTGTCTTTATTGCTGATTTATTTTGCT
GTTTTTATTTGCTATTTTATATTTGCTAATTYTCATTATTGCGAAATATATTACATTGCTATTTTTATTA
TATACGCTAGATTCAATTTTATTTTTYCTATATTTTCAATTTAATTTTGATTTCGAAGGTAAATATATAT
AATTRATTATTAAAAATGGCCTTTAGTTGTGGAACTCTYTCTTACTCTGCCGTCGCCCAAGCTCCGTCTG
TCGCYTATGCACCTCGTACATGGGAAGTTGATGAAGCTAGGCGGCGCCGAGTCATTAAACGTTTGGCGCT
GGAGCAAGAACGTATTCGTAACGTTCTTGACGTTGCCGTCTATGACCAGGCGACATGGGAACAGGAGGAC
GCGCGCGATAATGAGTTCCTAACGGAACAATTAAAYAATTTATATACTATTTATTCGATCGCTGAACGTT
GTACGCGTCGGCCTATCAAAGAGYACTCTCCTATATCAGTTTCGAATAGGTTTGCTCCACTGGARTCCCT
YAAGGTCGAGGTCGGTCAAGAAGCARGCGAATGTATRTTTAAGAAACCTAAATATACGCGCRTTTGCAAG
AAAGTGAAGCGTGTTGCAACTCGCTTCGTTCGTGAAAAAGTTGTTCGTCCTATGTGYTCWAGATCCCCTA
TGCTATTATTTAAGCTTAAGAAAATTATTTATGATTTGCATTTATATAGATTAAGAAAACAGATTAGGAT
GTTGAGACGTCAAAAACAGCGCGATTATGAGTTAGAGTGTGTCACTAATCTGYTACAATTATCGAATCCA
GTGCAGGCAAAACCAGAGATGGATAACCCTAATCCAGGACCTGATGGCGAGGGTGAAGTTGAATTAGAAA
AGGATAGCAATGTTGTTTTAACAACTCAGCGAGATCCTAGTACATCTATTCCAGCGCCGGTGAGCGTAAA
ATGGAGTAGATGGACTAGTAATGACGTAGTAGATGATTATGCCACAATCACATCTCGATGGTAYCAGATT
GCTGAATTTGTTTGGTCGAAGGATGATCCATTTGATAAGGAGTTAGCACGTTTAATTTTGCCTCGTGCTT
TGTTATCTAGTATAGAGGCTAATTCTGATGCTATATGTGATGTGCCTAATACTATCCCATTTAAGGTACA
CGCATATTGGCGAGGCGATATGGAAGTTAGAGTTCAAATTAATTCAAATAAATTCCAAGTTGGTCAATTA
CAAGCTACTTGGTATTATTCGGATCATGAGAATTTGAATATATCGTCTAAGAGAAGCGTTTATGGATTTT
CACAAATGGATCATGCTTTGATTAGTGCGTCAGCAAGTAATGAAGCAAAATTAGTTATTCCATATAAGCA
TGTTTATCCATTTTTACCGACAAGAATTGTGCCAGATTGGACTACTGGCATTTTAGATATGGGTGCTTTG
AACATTCGTGTAATTGCTCCCTTACGGATGAGTGCTACTGGTCCAACTACCTGTAATGTCGTCGTGTTTA
TTAAATTAAATAACAGCGAGTTTACAGGGACTTCTTCTGGTAAGTTTTATGCGAGCCAAATCAGGGCAAA
ACCTGAGATGGATCGTATATTAAATTTGGCAGAGGGATTGTTGAATAACACGATTGGTGGTAATAATATG
GATAATCCTTCTTATCAACAATCTCCTCGTCATTTTGTCCCGACTGGTATGCACAGCTTAGCTTTAGGTA
CTAATTTAGTTGAACCATTACATGCATTACGTTTRGATGCAGCCGGTACGACACAACATCCTGTAGGTTG
TGCTCCTGATGAAGATATGACTGTATCCTCCATTGCATCTCGATATGGACTAATTAGACGGGTACAATGG
AAGAAAGATCATGCTAAAGGATCACTTTTGTTACAATTAGATGCTGATCCATTTGTGGAGCAAAGAATTG
AAGGTACGAATCCAATATCYTTGTATTGGTTCGCACCCGTGGGTGTAGTATCTAGTATGTTTATGCAATG
GCGCGGTTCATTAGAATATAGGTTTGATATTATAGCATCCCAATTTCATACTGGTAGGTTAATTGTAGGT
TATGTGCCCGGTTTGACAGCATCTTTGCAACTTCAAATGGACTATATGAAATTGAAGTCATCGAGTTATG
TAGTATTTGATTTACAAGAAAGTAATAGCTTCACTTTTGAGGTGCCATAYGTTTCATATAGACCATGGTG
GGTGCGTAAATATGGTGGYAATTATTTACCCTCGTCAACTGACGCTCCTAGTACATTATTTATGTATGTK
CAGGTWCCRTTGATACCTATGGAAGCTGTTTCAGATACTATTGATATCAATGTGTACGTACGGGGCGGTA
GTTCATTTGAAGTTTGTGTTCCAGTCCAACCTAGTTTAGGTTTGAATTGGAATACAGACTTTATTTTACG
TAATGAYGAAGAATACAGGGCTAAGACAGGTTATGCACCATATTATGCTGGAGTGTGGCATAGCTTCAAT
AATAGTAATTCTCTTGTTTTTAGGTGGGGATCTGYTTCCGAYCAAATTGCTCAGTGGCCGACAATTTCAG
TACCAAGAGGTGAGCTAGCTTTCTTACGAATTAAGGATGGAAAGCAAGCTGCTGTAGGAACYCAACCTTG
GCGTACGATGGTTGTTTGGCCTTCTGGYCATGGTTATAATATTGGTATACCTACGTATAATGCTGAACGA
GCTCGCCAGCTTGCACAACACTTATATGGTGGTGGATCATTAACTGATGAGAAGGCCAAACAATTATTTG
TTCCTGCTAATCAACAAGGACCTGGTAAGGTAAGTAATGGAAATCCGGTATGGGAAGTCATGCGTGCACC
ATTGGCAACACAGCGTGCGCATATTCAAGATTTTGAATTTATTGAAGCTATTCCAGAAGGAGAGGAGTCT
CGTAATACTACAGTCTTGGATACGACCACTACTTTACAGTCGAGTGGATTTGGTCGCGCYTTCTTTGGAG
AAGCTTTTAATGAYCTTAAAACGTTAATGCGACGATATCAATTATATGGTCAATTATTATTGTCCGTTAC
TACGGATAAGGATATTGATCATTGTATGTTTACCTTCCCTTGTTTACCACAAGGGTTAGCGTTAGACATT
GGTTCTGCTGGCTCTCCACATGAAATCTTTAATAGATGTCGTGATGGTATTATACCATTAATTGCATCTG
GATATAGATTTTATAGAGGAGATTTGCGTTATAAGATTGTTTTTCCAAGTAATGTTAATAGCAACATTTG
GGTACAACATCGACCGGATCGTAGACTGGAAGGATGGTCCGCGGCTAAGATTGTAAATTGTGATGCTGTG
TCTACTGGTCAAGGGGTGTATAATCATGGTTATGCTAGTCACATTCAAATCACGCGTGTAAATAATGTTA
TAGAATTGGAAGTTCCATTTTATAATGCTACTTGTTATAATTATTTACAGGCGTTTAATGCGTCTAGCGC
TGCATCTAGTTATGCAGTATCTTTAGGAGAAATATCGGTTGGTTTTCAAGCTACAAGTGATGATATTGCA
TCTATTGTTAACAAACCTGTTACTATTTATTATAGTATTGGAGATGGTATGCAATTTTCTCAGTGGGTTG
GATATCAACCGATGATGATCCTAGATCAGCTYCCTGCACCAGTAGTAAGGGCCGTGCCTGAGGGCCCTAT
TGCGAAGATTAAAAACTTCTTCCATCAAACAGCCGAYGAAGTTAGAGAAGCTCAGGCAGCAAAGATGCGT
GAAGATATGGGTATGGTTGTCCAAGATGTTATTGGAGAACTTAGCCAGGCYATACCGGATCTTCAACAAC
CGGAGGTTCAAGCAAATGTCTTCTCACTGGTGTCTCAGTTAGTGCATGCTATTATAGGTACTAGTTTGAA
GACAGTTGCTTGGGCGATTGTTTCGATTTTTGTGACTTTAGGATTAATTGGACGCGAAATGATGCATTCA
GTTATTACTGTAGTCAAGCGGTTACTTGAGAAATATCACTTGGCGACGCAACCCCAGGAATCCGCCAGTT
CAAGTACTGTTATATCTGCCGTTCCAGAAGCTCCCAATGCTGAAGCGGAGGAGGCAAGTGCTTGGGTATC
CATTATTTATAATGGTGTGTGTAATATGCTTAATGTRGCTGCTCAAAAACCGAAACAATTTAAAGATTGG
GTAAAATTAGCTACTGTAGATTTTAGTAATAATTGTAGAGGTAGTAACCAGGTATTTGTATTTTTCAAGA
ATACATTTGAAGTGTTGAAGAAAATGTGGGGTTATGTATTTTGTCAGAGTAATCCTGCAGCGCGTTTGTT
GAAAGCTGTGAATGACGAGCCTGAGATTTTGAAAGCATGGGTGAAGGAATGTCTGTATTTGGATGATCCC
AAATTCAGAATGCGTCGAGCGCATGATCAAGAGTATATCGAGAGAGTGTTTGCGGCACATTCATATGGAC
AAATTTTGCTACATGATTTAACTGCTGAAATGAATCAATCACGAAATTTGAGTGTGTTTACACGTGTGTA
TGATCAAATTTCAAAATTGAAGACCGATCTTATGGAAATGGGATCGAATCCATATATAAGGCGTGAATGT
TTTACGATATGCATGTGTGGTGCATCTGGAATTGGAAAATCATATTTGACCGATTCTTTATGCAGCGAGC
TCTTACGTGCGAGTCGTACTCCTGTGACAACAGGCATAAAATGTGTTGTTAATCCATTATCTGATTATTG
GGATCAATGTGATTTTCAGCCTGTTTTGTGCGTTGACGATATGTGGAGTGTTGAAACATCTACTACGCTY
GATAAGCAGTTGAATATGCTTTTCCAGGTCCATTCCCCTATCGTGCTTTCTCCTCCTAAAGCTGATTTAG
AAGGTAAGAAAATGCGATATAACCCGGAAATATTCATATACAATACGAATAAACCTTTCCCGAGGTTTGA
TCGTATTGCTATGGAAGCTATTTATCGGCGTAGAAATGTTTTGATTGAATGTAAAGCGAGTGAAGAGAAG
AAGCGAGGATGTAAGCATTGTGAGAATGATATTCCTATTGCTGAATGTAGTCCTAAGATGTTGAAAGATT
TTCATCATATTAAATTTAGGTATGCGCATGATGTATGTAATTCCGAGACCACATGGTCTGAATGGATGAC
GTATAATGAATTTCTTGAATGGATAACTCCTGTGTATATGGCTAACCGTCGTAAGGCGAATGAATCGTTT
AAGATGCGTGTGGATGAAATGCAAATGTTACGTATGGATGAACCATTGGAAGGTGATAATATTCTCAATA
AGTATGTTGAAGTTAATCAGCGCTTAGTGGAGGAAATGAAGGCATTTAAGGAGCGTACACTATGGTCAGA
TTTACATCGCGTAGGTGCGGAAATTAGTGCGTCAGTTAAGAAAGCTTTACCAACCATTTCCATAACCGAA
AAAYTACCACATTGGACTGTTCAATGTGGTATTGCTAAACCTGARATGGACCATGCTTATGAGGTTATGA
GTTCGTATGCAGCTGGAATGAATGCAGAGATTGAAGCGCATGAACAAGTTCGGCGTTCRTCAGTGGAATG
TCAATTTGCAGAGCCTCAAGCTYCAAGAAAYCCTGATGATGAAGGACCAACCATAGATGAAGAACTTATG
GGCGACACTGAATTCACATCACAGGCTCTAGAACGTCTTGTGGATGAAGGTTATATAACTGGAAAACAGA
AGAAATATATAGCTATGTGGTGTAGTAAGCGTCGTGAACATACTGCTGACTTTGATCTTGTGTGGACTGA
TAATTTGCGTGTGTTAAGTGCGTATGTGCATGAACGTTCATCTTCAACTCGGCTTTCTACGGATGACGTC
AAGTTATATAAAACGATTAGCATGTTACATCAAAAGTATGATACCACAGAGTGTGCTAAATGTCAACATT
GGTATGCTCCGTTGACTGATATCTATGTTGATGACAAGAAATTGTTYTGGTGTCAGAAAGAGAAAAAGAC
ACTTATTGATGTCCGAAAATTGTCGAAAGAAGATGTGACTGTTCAATCRAAATTGRTTAATTTATCTGTT
CCTTGTGGTGAAGTKTGTATGTTACATTCAAAATATTTYAATTATCTTTTCCATAAAGCATGGTTGTTTG
AGAACCCAACTTGGCGCCTAATATATAATGGTACCAAGAAGGGTATGCCCGAGTACTTTATGAATTGTGT
GGATGAAATTTCATTAGATTCCAAATTTGGTAAAGTGAAAGTGTGGTTGCAAGCGATCATTGATAAGTAT
TTAACTCGTCCCGTGAAAATGATTCGTGATTTTCTTTTCAAGTGGTGGCCGCAAGTTGCGTATGTGTTGA
GCTTGCTAGGTATAATYGGTATAACTGCGTATGAAATGAGAAATCCGAAACCAACTTCTGAGGAATTAGC
TGATCATTATGTGAATAGGCATTGTAGCTCTGATTTTTGGTCACCAGGACTGGCATCACCTCAAGGATTG
AAATATAGTGAAGCAGTAACAGTAAAGGCACCTAGAATCCATAGATTGCCAGTTACTACTAAGCCTCAGG
GATCAACACAACAAGTAGACGCTGCTGTGAATAAAATTTTACAGAAYATGGTTTACATTGGTGTTGTTTT
CCCAAAAGTGCCTGGTAGTAAGTGGCGAGATATTAATTTTAGGTGTCTTATGCTTCATAATAGGCAATGT
TTAATGTTGAGGCATTATATTGAGTCRACTGCTGCCTTTCCTGAGGGAACCAAGTACTATTTYAAGTATA
TTCATAATCAAGAGACTAGAATGTCTGGTGATATTTCTGGTATTGAAATTGATTTGTTGAATTTACCTAG
ATTGTATTATGGTGGTCTCGCGGGAGAGGAGTCATTTGATAGCAATATCGTGCTTGTGACTATGCCTAAT
CGTATTCCTGAGTGTAAGAGCATTATTAAATTTATAGCGTCACATAATGAACATATACGTGCTCAGAATG
ATGGAGTGTTAGTAACTGGCGACCATACTCAGTTATTGGCTTTCGAGAATAATAATAAGACCCCAATAAG
TATCAACGCTGATGGTTTGTATGAGGTTATACTTCAAGGAGTATATACTTATCCATACCATGGCGATGGT
GTTTGTGGTTCGATATTGCTGTCTCGGAATTTACAACGGCCAATTATAGGTATCCATGTTGCTGGTACTG
AAGGATTGCATGGCTTTGGAGTYGCTGAACCAYTGGTACATGAAATGTTCACCGGTAAAGCAATCGAGAG
TGAAAGAGAGCCGTATGATCGTGTGTATGAACTTCCGTTGCGTGAATTAGATGAATCTGATATTGGTTTA
GATACCGATTTATATCCGATTGGTAGAGTGGATGCAAAGTTAGCTCATGCTCAAAGCCCTTCTACTGGGA
TCAAAAAGACGCTTATCCATGGAACATTTGATGTAAGGACTGAACCAAATCCGATGTCGTCACGTGATCC
AAGAATAGCGCCGCATGATCCTTTGAAGTTAGGGTGTGAAAAGCATGGTATGCCTTGTTCACCGTTTAAT
AGGAAACATCTGGAATTAGCGACAAATCATTTGAAAGAAAAATTAGTTTCAGTAGTTAAACCAATAAATG
GTTGCAAGATTAGAAGTTTGCAAGATGCTRTATGTGGTGTGCCTGGTTTAGATGGGTTTGATTCGATATC
TTGGAATACTAGTGCTGGTTTTCCTTTGTCTTCATTAAAGCCACCTGGAACATCAGGYAAGCGATGGTTG
TTTGAYATTGAGCTACAAGAYTCGGGATGTTATCTCYTGCGTGGAATGCGTCCCGAACTTGAGATTCAAT
TATCAACGACACAGTTAATGAGGAAAAAGGGAATAAAACCTCACACTATATTCACGGATTGTTTGAAAGA
TACTTGTTTGCCTGTTGAAAAATGTAGAATACCTGGTAAGACTAGAATATTTAGTATAAGTCCGGTACAG
TTTACCATACCGTTTCGACAGTATTACTTAGACTTTATGGCATCCTATCGAGCTGCACGACTTAATGCTG
AGCATGGTATTGGTATTGATGTTAACAGCTTAGAGTGGACAAATTTGGCAACAAGGTTGTCTAAGTWTGG
CACTCACATCGTGACAGGAGATTATAAGAATTTTGGTCCTGGGTTAGATTCCGATGTTGCAGCTTCAGCG
TTCGAAATTATTATCGACTGGGTATTACATTACACCGAAGAAGATAATAAAGAYGAAATGAAGCGAGTAA
TGTGGACCATGGCGCAAGAGATCTTAGCGCCTAGTCATCTATATCGCGACYTGGTGTACCGAGTACCTTG
TGGAATTCCATCAGGTTCTCCAATAACGGACATATTGAAYACAATTTCAAATTGTTTGTTAATTAGGTTA
GCTTGGTTAGGTATTACTGACTTGCCTTTGTCCGAGTTCTCTCAAAATGTTGTTCTTGTCTGTTATGGCG
ACGATCTTATCATGAATGTTAGYGATAACATGATTGATAAGTTTAATGCCGTGACGATAGGAAAATTCTT
TTCACAATATAAGATGGAATTTACGGATCAGGATAAATCAGGAAATACTGTAAAGTGGCGGACGTTACAG
ACTGCTACTTTCTTAAAACATGGGTTCTTAAAACATCCAACTAGACCTGTGTTTCTAGCTAACCTGGACA
AGGTCTCGGTAGAAGGAACGACGAATTGGACTCATGCTCGAGGATTGGGTCGTCGTACAGCAACCATAGA
AAATGCTAAACAAGCGTTAGAGTTAGCATTTGGGTGGGGTCCTGAATATTTTAATTATGTCAGAAATACC
ATTAAAATGGCTTTTGACAAGTTGGGTATTTATGAGGACCTTATCACATGGGAAGAAATGGATGTTAGAT
GTTACGCTAGTGCGTAATATTAAATTTTAAATACTCATTAATTTTAATTTTATTTTAGGTTATTGGAATT
GAGGGAAGTACCACCCCCCAAGACCTTCGTTTTAAATCTACTAAGAGGAGTAAACCTATATATAAGAGTC
TAAAGACAGAGTGGATTAGACCATCATCTTTAGCTTATATACGGGGAAGGTTGAGTTGCCTCTAAAGACT
CAGCTCCATAGTAGAGTAGTTTTAATTACGATTAAAGTGGTACTCTAGGTTAGGTGTTACTCGCGTATTA
TCAACTAGTGGTAATGCGTCCTAATTTTAGTATAGTTTTAACCATAATAGT